Incidental Mutation 'R8138:Ppp1r16a'
ID 632374
Institutional Source Beutler Lab
Gene Symbol Ppp1r16a
Ensembl Gene ENSMUSG00000033819
Gene Name protein phosphatase 1, regulatory (inhibitor) subunit 16A
Synonyms R75527, Mypt3, 2900084E10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock # R8138 (G1)
Quality Score 167.009
Status Validated
Chromosome 15
Chromosomal Location 76671615-76694919 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76691721 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 95 (V95A)
Ref Sequence ENSEMBL: ENSMUSP00000037356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037551] [ENSMUST00000135388] [ENSMUST00000150399] [ENSMUST00000229679] [ENSMUST00000231028]
AlphaFold Q923M0
Predicted Effect probably damaging
Transcript: ENSMUST00000037551
AA Change: V95A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037356
Gene: ENSMUSG00000033819
AA Change: V95A

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
ANK 231 260 2.58e-3 SMART
ANK 264 293 4.03e-5 SMART
low complexity region 323 346 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135388
AA Change: V95A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000150399
AA Change: V95A

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123458
Gene: ENSMUSG00000033819
AA Change: V95A

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
Predicted Effect silent
Transcript: ENSMUST00000156920
Predicted Effect probably benign
Transcript: ENSMUST00000229679
Predicted Effect probably benign
Transcript: ENSMUST00000231028
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin light chain kinase and phosphatase (MLCP) complexes control the phosphorylation states of regulatory myosin light chains, which is crucial for muscle and intracellular movement. MLCPs typically contain a catalytic protein phosphatase 1 (PP1c) subunit, a myosin phosphatase targeting (MYPT) subunit, and another smaller subunit. The protein encoded by this gene represents an MYPT subunit, which is responsible for directing PP1c to its intended targets. However, while other MYPTs result in PP1c activation after becoming phosphorylated, the encoded protein is phosphorylated by protein kinase A and then inhibits the catalytic activity of PP1c. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat A G 16: 8,600,965 D141G probably benign Het
Abcc1 A G 16: 14,472,887 T1454A probably damaging Het
Acan C A 7: 79,098,427 T982N probably benign Het
Adam5 A G 8: 24,781,762 L543P probably damaging Het
Akap13 T A 7: 75,702,231 probably null Het
Akirin1 G A 4: 123,743,445 P116S probably benign Het
Bzw2 T C 12: 36,109,820 D236G probably benign Het
C1qtnf2 G A 11: 43,486,011 G70D probably damaging Het
Cd44 A G 2: 102,832,497 I566T probably benign Het
Cltb C T 13: 54,598,783 D135N possibly damaging Het
Cpeb2 T C 5: 43,235,009 V516A Het
Cx3cr1 A T 9: 120,051,583 M251K possibly damaging Het
Ect2l A T 10: 18,169,405 S301T probably damaging Het
Fgd6 A G 10: 94,134,143 K1218R probably null Het
Fsip2 T C 2: 82,975,797 V820A possibly damaging Het
Gnas A G 2: 174,298,386 E116G probably benign Het
Greb1l T C 18: 10,533,060 Y985H probably benign Het
Gtpbp3 T C 8: 71,492,598 L438P probably damaging Het
Habp4 A G 13: 64,176,070 D269G possibly damaging Het
Igf2r A T 17: 12,701,238 S1405T probably benign Het
Il17rc A G 6: 113,482,539 D482G probably damaging Het
Kmt2d A G 15: 98,843,653 I4542T unknown Het
Lag3 A G 6: 124,905,492 V347A probably damaging Het
Lmtk2 C T 5: 144,175,597 S1045L probably damaging Het
Mblac2 A G 13: 81,711,650 D41G probably damaging Het
Mfsd6 C T 1: 52,709,512 V65I probably benign Het
Neb A G 2: 52,175,695 V6175A possibly damaging Het
Nin A G 12: 70,042,898 S1248P Het
Nlrp4b A T 7: 10,715,531 M554L probably benign Het
Olfr1055 T C 2: 86,347,586 Y60C possibly damaging Het
Olfr235 G A 19: 12,269,072 V281M possibly damaging Het
Olfr483 A T 7: 108,103,557 S83C possibly damaging Het
Olfr613 T A 7: 103,552,059 H91Q probably benign Het
Pik3r4 C A 9: 105,669,035 S861R possibly damaging Het
Prss40 T C 1: 34,557,999 Q156R probably damaging Het
Rhbdd3 CACCATGGCTGCTACCATGGCTGCT CACCATGGCTGCT 11: 5,104,303 probably benign Het
Rnf170 T C 8: 26,125,981 probably null Het
Smlr1 A G 10: 25,536,041 V16A probably benign Het
Sowahb A G 5: 93,043,483 L459P probably benign Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Tpo T C 12: 30,074,104 D899G probably benign Het
Traj7 C T 14: 54,211,525 P19S Het
Trit1 G A 4: 123,043,789 W131* probably null Het
Vcpip1 GGGAGGCGGCGGCGGCGGCAGCGGAGGAGGCGGCGGCGGC GGGAGGAGGCGGCGGCGGC 1: 9,748,109 probably benign Het
Vmn1r4 A G 6: 56,957,406 *298W probably null Het
Vmn2r124 T A 17: 18,063,348 W435R probably damaging Het
Zbtb41 C T 1: 139,441,807 R641C probably damaging Het
Zfp84 T A 7: 29,775,372 F23Y probably damaging Het
Zfp879 G T 11: 50,833,448 Y260* probably null Het
Zswim9 A T 7: 13,261,411 F273Y probably damaging Het
Other mutations in Ppp1r16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Ppp1r16a APN 15 76694544 missense probably benign
IGL01449:Ppp1r16a APN 15 76694294 unclassified probably benign
IGL02128:Ppp1r16a APN 15 76693978 missense probably benign
IGL02331:Ppp1r16a APN 15 76691000 missense probably benign
R0057:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0060:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0113:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0114:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0244:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0352:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0646:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0652:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0722:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0744:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0833:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0834:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0835:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0836:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0885:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0942:Ppp1r16a UTSW 15 76694011 missense probably damaging 0.98
R1061:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1168:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1170:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1171:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1503:Ppp1r16a UTSW 15 76694399 missense probably benign
R1572:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1914:Ppp1r16a UTSW 15 76693068 missense probably damaging 1.00
R1915:Ppp1r16a UTSW 15 76693068 missense probably damaging 1.00
R2085:Ppp1r16a UTSW 15 76693596 missense probably damaging 0.99
R4823:Ppp1r16a UTSW 15 76693193 unclassified probably benign
R5153:Ppp1r16a UTSW 15 76694396 nonsense probably null
R5443:Ppp1r16a UTSW 15 76694646 missense possibly damaging 0.95
R5481:Ppp1r16a UTSW 15 76691021 missense probably damaging 1.00
R6900:Ppp1r16a UTSW 15 76691723 missense probably damaging 1.00
R7165:Ppp1r16a UTSW 15 76690904 missense probably damaging 1.00
R7686:Ppp1r16a UTSW 15 76694583 missense probably benign 0.37
R9150:Ppp1r16a UTSW 15 76690854 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CACGGACAGTGTTGTTCATTTC -3'
(R):5'- AGCTGCTGTGCCATCTCTTG -3'

Sequencing Primer
(F):5'- CATTTCTGGTTAGAGATGAAGTGAG -3'
(R):5'- ACTCCTGCAGGCACTCACCTGGT -3'
Posted On 2020-06-30