Incidental Mutation 'R8138:Igf2r'
ID 632379
Institutional Source Beutler Lab
Gene Symbol Igf2r
Ensembl Gene ENSMUSG00000023830
Gene Name insulin-like growth factor 2 receptor
Synonyms M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent
MMRRC Submission 067566-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.919) question?
Stock # R8138 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 12682406-12769664 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 12701238 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1405 (S1405T)
Ref Sequence ENSEMBL: ENSMUSP00000024599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024599]
AlphaFold Q07113
Predicted Effect probably benign
Transcript: ENSMUST00000024599
AA Change: S1405T

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: S1405T

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
Pfam:CIMR 118 266 5.1e-21 PFAM
Pfam:CIMR 272 416 8.8e-22 PFAM
Pfam:CIMR 418 567 3.4e-53 PFAM
Pfam:CIMR 569 709 6.5e-47 PFAM
Pfam:CIMR 713 869 6.5e-34 PFAM
Pfam:CIMR 876 1020 1.9e-10 PFAM
Pfam:CIMR 1024 1171 1e-60 PFAM
Pfam:CIMR 1172 1313 1.2e-17 PFAM
Pfam:CIMR 1315 1455 2.1e-58 PFAM
Pfam:CIMR 1458 1592 1.8e-22 PFAM
Pfam:CIMR 1596 1743 9.1e-23 PFAM
Pfam:CIMR 1748 1887 2.5e-22 PFAM
FN2 1889 1935 9.51e-26 SMART
Pfam:CIMR 1939 2076 2.1e-22 PFAM
Pfam:CIMR 2230 2294 4.9e-9 PFAM
transmembrane domain 2295 2317 N/A INTRINSIC
low complexity region 2336 2363 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000124664
Gene: ENSMUSG00000023830
AA Change: S14T

DomainStartEndE-ValueType
Pfam:CIMR 1 65 3.1e-24 PFAM
Pfam:CIMR 68 129 6.1e-15 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat A G 16: 8,600,965 (GRCm38) D141G probably benign Het
Abcc1 A G 16: 14,472,887 (GRCm38) T1454A probably damaging Het
Acan C A 7: 79,098,427 (GRCm38) T982N probably benign Het
Adam5 A G 8: 24,781,762 (GRCm38) L543P probably damaging Het
Akap13 T A 7: 75,702,231 (GRCm38) probably null Het
Akirin1 G A 4: 123,743,445 (GRCm38) P116S probably benign Het
Bzw2 T C 12: 36,109,820 (GRCm38) D236G probably benign Het
C1qtnf2 G A 11: 43,486,011 (GRCm38) G70D probably damaging Het
Cd44 A G 2: 102,832,497 (GRCm38) I566T probably benign Het
Cltb C T 13: 54,598,783 (GRCm38) D135N possibly damaging Het
Cpeb2 T C 5: 43,235,009 (GRCm38) V516A Het
Cx3cr1 A T 9: 120,051,583 (GRCm38) M251K possibly damaging Het
Ect2l A T 10: 18,169,405 (GRCm38) S301T probably damaging Het
Fgd6 A G 10: 94,134,143 (GRCm38) K1218R probably null Het
Fsip2 T C 2: 82,975,797 (GRCm38) V820A possibly damaging Het
Gnas A G 2: 174,298,386 (GRCm38) E116G probably benign Het
Greb1l T C 18: 10,533,060 (GRCm38) Y985H probably benign Het
Gtpbp3 T C 8: 71,492,598 (GRCm38) L438P probably damaging Het
Habp4 A G 13: 64,176,070 (GRCm38) D269G possibly damaging Het
Il17rc A G 6: 113,482,539 (GRCm38) D482G probably damaging Het
Kmt2d A G 15: 98,843,653 (GRCm38) I4542T unknown Het
Lag3 A G 6: 124,905,492 (GRCm38) V347A probably damaging Het
Lmtk2 C T 5: 144,175,597 (GRCm38) S1045L probably damaging Het
Mblac2 A G 13: 81,711,650 (GRCm38) D41G probably damaging Het
Mfsd6 C T 1: 52,709,512 (GRCm38) V65I probably benign Het
Neb A G 2: 52,175,695 (GRCm38) V6175A possibly damaging Het
Nin A G 12: 70,042,898 (GRCm38) S1248P Het
Nlrp4b A T 7: 10,715,531 (GRCm38) M554L probably benign Het
Olfr1055 T C 2: 86,347,586 (GRCm38) Y60C possibly damaging Het
Olfr235 G A 19: 12,269,072 (GRCm38) V281M possibly damaging Het
Olfr483 A T 7: 108,103,557 (GRCm38) S83C possibly damaging Het
Olfr613 T A 7: 103,552,059 (GRCm38) H91Q probably benign Het
Pik3r4 C A 9: 105,669,035 (GRCm38) S861R possibly damaging Het
Ppp1r16a T C 15: 76,691,721 (GRCm38) V95A probably damaging Het
Prss40 T C 1: 34,557,999 (GRCm38) Q156R probably damaging Het
Rhbdd3 CACCATGGCTGCTACCATGGCTGCT CACCATGGCTGCT 11: 5,104,303 (GRCm38) probably benign Het
Rnf170 T C 8: 26,125,981 (GRCm38) probably null Het
Smlr1 A G 10: 25,536,041 (GRCm38) V16A probably benign Het
Sowahb A G 5: 93,043,483 (GRCm38) L459P probably benign Het
Srebf2 C T 15: 82,178,765 (GRCm38) R468C probably damaging Het
Tpo T C 12: 30,074,104 (GRCm38) D899G probably benign Het
Traj7 C T 14: 54,211,525 (GRCm38) P19S Het
Trit1 G A 4: 123,043,789 (GRCm38) W131* probably null Het
Vcpip1 GGGAGGCGGCGGCGGCGGCAGCGGAGGAGGCGGCGGCGGC GGGAGGAGGCGGCGGCGGC 1: 9,748,109 (GRCm38) probably benign Het
Vmn1r4 A G 6: 56,957,406 (GRCm38) *298W probably null Het
Vmn2r124 T A 17: 18,063,348 (GRCm38) W435R probably damaging Het
Zbtb41 C T 1: 139,441,807 (GRCm38) R641C probably damaging Het
Zfp84 T A 7: 29,775,372 (GRCm38) F23Y probably damaging Het
Zfp879 G T 11: 50,833,448 (GRCm38) Y260* probably null Het
Zswim9 A T 7: 13,261,411 (GRCm38) F273Y probably damaging Het
Other mutations in Igf2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Igf2r APN 17 12,713,990 (GRCm38) missense probably benign 0.01
IGL00534:Igf2r APN 17 12,739,328 (GRCm38) missense probably damaging 0.97
IGL00902:Igf2r APN 17 12,700,358 (GRCm38) missense probably damaging 0.99
IGL00903:Igf2r APN 17 12,683,867 (GRCm38) missense possibly damaging 0.70
IGL01160:Igf2r APN 17 12,704,775 (GRCm38) missense possibly damaging 0.73
IGL01380:Igf2r APN 17 12,695,374 (GRCm38) missense probably benign 0.01
IGL01392:Igf2r APN 17 12,704,349 (GRCm38) missense probably benign
IGL01557:Igf2r APN 17 12,704,635 (GRCm38) missense possibly damaging 0.82
IGL01568:Igf2r APN 17 12,683,985 (GRCm38) missense possibly damaging 0.93
IGL01611:Igf2r APN 17 12,725,415 (GRCm38) nonsense probably null
IGL01720:Igf2r APN 17 12,701,313 (GRCm38) missense probably damaging 0.99
IGL01756:Igf2r APN 17 12,683,822 (GRCm38) missense probably benign
IGL01839:Igf2r APN 17 12,705,022 (GRCm38) missense probably damaging 1.00
IGL01904:Igf2r APN 17 12,714,911 (GRCm38) missense probably damaging 0.99
IGL01965:Igf2r APN 17 12,704,338 (GRCm38) missense probably benign 0.12
IGL02083:Igf2r APN 17 12,693,192 (GRCm38) nonsense probably null
IGL02095:Igf2r APN 17 12,702,005 (GRCm38) missense probably damaging 0.99
IGL02183:Igf2r APN 17 12,698,516 (GRCm38) unclassified probably benign
IGL02576:Igf2r APN 17 12,748,763 (GRCm38) missense possibly damaging 0.90
IGL02649:Igf2r APN 17 12,712,087 (GRCm38) missense possibly damaging 0.93
IGL02807:Igf2r APN 17 12,719,883 (GRCm38) missense probably damaging 0.98
IGL02833:Igf2r APN 17 12,692,723 (GRCm38) missense probably damaging 0.97
IGL02885:Igf2r APN 17 12,694,120 (GRCm38) missense possibly damaging 0.94
IGL02990:Igf2r APN 17 12,710,746 (GRCm38) splice site probably benign
IGL03080:Igf2r APN 17 12,726,676 (GRCm38) missense probably benign 0.06
IGL03176:Igf2r APN 17 12,716,672 (GRCm38) missense probably damaging 1.00
blunt UTSW 17 12,722,175 (GRCm38) missense probably benign 0.02
brusque UTSW 17 12,714,951 (GRCm38) missense probably damaging 0.98
gruff UTSW 17 12,684,097 (GRCm38) missense probably damaging 0.96
outlier UTSW 17 12,695,314 (GRCm38) missense probably benign 0.20
NA:Igf2r UTSW 17 12,691,962 (GRCm38) missense probably benign
R0165:Igf2r UTSW 17 12,698,527 (GRCm38) missense probably benign 0.07
R0412:Igf2r UTSW 17 12,683,948 (GRCm38) missense probably damaging 0.98
R0523:Igf2r UTSW 17 12,692,064 (GRCm38) missense probably benign 0.27
R0631:Igf2r UTSW 17 12,717,274 (GRCm38) splice site probably null
R0722:Igf2r UTSW 17 12,715,495 (GRCm38) critical splice acceptor site probably null
R0894:Igf2r UTSW 17 12,692,101 (GRCm38) missense probably benign 0.02
R1265:Igf2r UTSW 17 12,694,124 (GRCm38) missense probably damaging 0.98
R1466:Igf2r UTSW 17 12,717,269 (GRCm38) splice site probably benign
R1485:Igf2r UTSW 17 12,691,285 (GRCm38) missense probably damaging 1.00
R1633:Igf2r UTSW 17 12,726,309 (GRCm38) missense probably benign
R1693:Igf2r UTSW 17 12,704,316 (GRCm38) missense probably damaging 0.97
R1751:Igf2r UTSW 17 12,697,441 (GRCm38) missense possibly damaging 0.94
R1843:Igf2r UTSW 17 12,704,270 (GRCm38) critical splice donor site probably null
R1981:Igf2r UTSW 17 12,733,903 (GRCm38) nonsense probably null
R1994:Igf2r UTSW 17 12,692,738 (GRCm38) missense probably benign
R2060:Igf2r UTSW 17 12,701,319 (GRCm38) missense possibly damaging 0.92
R2108:Igf2r UTSW 17 12,698,251 (GRCm38) missense probably benign 0.02
R2132:Igf2r UTSW 17 12,722,208 (GRCm38) missense probably benign 0.12
R2314:Igf2r UTSW 17 12,715,943 (GRCm38) missense probably benign 0.28
R2349:Igf2r UTSW 17 12,722,311 (GRCm38) splice site probably null
R2696:Igf2r UTSW 17 12,695,344 (GRCm38) missense possibly damaging 0.96
R2864:Igf2r UTSW 17 12,686,724 (GRCm38) missense probably damaging 0.99
R2865:Igf2r UTSW 17 12,686,724 (GRCm38) missense probably damaging 0.99
R3884:Igf2r UTSW 17 12,709,468 (GRCm38) missense probably benign
R3930:Igf2r UTSW 17 12,705,829 (GRCm38) missense probably benign 0.01
R4021:Igf2r UTSW 17 12,748,751 (GRCm38) missense probably damaging 0.97
R4125:Igf2r UTSW 17 12,702,254 (GRCm38) missense possibly damaging 0.93
R4342:Igf2r UTSW 17 12,709,511 (GRCm38) missense possibly damaging 0.95
R4343:Igf2r UTSW 17 12,709,511 (GRCm38) missense possibly damaging 0.95
R4345:Igf2r UTSW 17 12,709,511 (GRCm38) missense possibly damaging 0.95
R4760:Igf2r UTSW 17 12,703,465 (GRCm38) missense possibly damaging 0.92
R4796:Igf2r UTSW 17 12,684,126 (GRCm38) missense possibly damaging 0.70
R4816:Igf2r UTSW 17 12,684,097 (GRCm38) missense probably damaging 0.96
R4826:Igf2r UTSW 17 12,701,353 (GRCm38) missense probably damaging 0.98
R4933:Igf2r UTSW 17 12,691,877 (GRCm38) splice site probably null
R4980:Igf2r UTSW 17 12,703,360 (GRCm38) critical splice donor site probably null
R5389:Igf2r UTSW 17 12,725,416 (GRCm38) missense probably damaging 1.00
R5473:Igf2r UTSW 17 12,695,314 (GRCm38) missense probably benign 0.20
R5494:Igf2r UTSW 17 12,693,145 (GRCm38) missense possibly damaging 0.74
R5619:Igf2r UTSW 17 12,739,334 (GRCm38) missense probably damaging 1.00
R5738:Igf2r UTSW 17 12,717,367 (GRCm38) missense probably benign 0.23
R5761:Igf2r UTSW 17 12,698,352 (GRCm38) splice site probably null
R5794:Igf2r UTSW 17 12,709,445 (GRCm38) missense probably benign 0.37
R6210:Igf2r UTSW 17 12,714,951 (GRCm38) missense probably damaging 0.98
R6319:Igf2r UTSW 17 12,714,113 (GRCm38) missense probably damaging 1.00
R6388:Igf2r UTSW 17 12,683,900 (GRCm38) missense probably benign
R6396:Igf2r UTSW 17 12,714,090 (GRCm38) missense probably benign 0.00
R6584:Igf2r UTSW 17 12,701,250 (GRCm38) missense probably damaging 0.99
R6590:Igf2r UTSW 17 12,691,937 (GRCm38) nonsense probably null
R6591:Igf2r UTSW 17 12,689,008 (GRCm38) missense probably damaging 1.00
R6599:Igf2r UTSW 17 12,698,618 (GRCm38) missense possibly damaging 0.85
R6690:Igf2r UTSW 17 12,691,937 (GRCm38) nonsense probably null
R6691:Igf2r UTSW 17 12,689,008 (GRCm38) missense probably damaging 1.00
R6752:Igf2r UTSW 17 12,714,944 (GRCm38) missense probably damaging 1.00
R6816:Igf2r UTSW 17 12,714,082 (GRCm38) missense probably damaging 0.99
R6841:Igf2r UTSW 17 12,703,376 (GRCm38) missense probably damaging 0.97
R6877:Igf2r UTSW 17 12,697,341 (GRCm38) missense probably damaging 0.97
R6950:Igf2r UTSW 17 12,718,718 (GRCm38) missense probably benign
R7030:Igf2r UTSW 17 12,733,866 (GRCm38) missense probably damaging 1.00
R7038:Igf2r UTSW 17 12,698,325 (GRCm38) missense probably benign 0.23
R7055:Igf2r UTSW 17 12,704,323 (GRCm38) missense probably damaging 0.99
R7074:Igf2r UTSW 17 12,714,116 (GRCm38) missense possibly damaging 0.57
R7348:Igf2r UTSW 17 12,703,484 (GRCm38) missense probably damaging 0.99
R7413:Igf2r UTSW 17 12,698,228 (GRCm38) nonsense probably null
R7463:Igf2r UTSW 17 12,710,645 (GRCm38) missense probably benign 0.16
R7619:Igf2r UTSW 17 12,698,273 (GRCm38) missense possibly damaging 0.88
R7730:Igf2r UTSW 17 12,735,991 (GRCm38) missense probably damaging 0.98
R7733:Igf2r UTSW 17 12,739,369 (GRCm38) missense possibly damaging 0.90
R7881:Igf2r UTSW 17 12,748,704 (GRCm38) missense probably benign
R8022:Igf2r UTSW 17 12,718,795 (GRCm38) missense probably damaging 1.00
R8220:Igf2r UTSW 17 12,692,071 (GRCm38) missense probably benign 0.22
R8305:Igf2r UTSW 17 12,733,860 (GRCm38) missense probably benign
R8359:Igf2r UTSW 17 12,683,861 (GRCm38) missense probably benign
R8500:Igf2r UTSW 17 12,709,441 (GRCm38) missense probably damaging 0.99
R8510:Igf2r UTSW 17 12,704,313 (GRCm38) missense probably benign 0.38
R8933:Igf2r UTSW 17 12,704,637 (GRCm38) missense probably damaging 1.00
R8933:Igf2r UTSW 17 12,701,244 (GRCm38) missense probably damaging 0.97
R8976:Igf2r UTSW 17 12,726,772 (GRCm38) missense probably damaging 1.00
R8994:Igf2r UTSW 17 12,716,650 (GRCm38) missense possibly damaging 0.87
R9059:Igf2r UTSW 17 12,751,293 (GRCm38) start codon destroyed probably null
R9097:Igf2r UTSW 17 12,691,213 (GRCm38) missense probably damaging 1.00
R9127:Igf2r UTSW 17 12,739,351 (GRCm38) missense probably damaging 0.98
R9278:Igf2r UTSW 17 12,695,353 (GRCm38) missense probably damaging 1.00
R9362:Igf2r UTSW 17 12,722,175 (GRCm38) missense probably benign 0.02
R9371:Igf2r UTSW 17 12,705,759 (GRCm38) missense possibly damaging 0.93
R9522:Igf2r UTSW 17 12,698,328 (GRCm38) missense probably benign 0.26
R9567:Igf2r UTSW 17 12,686,754 (GRCm38) missense probably damaging 1.00
R9665:Igf2r UTSW 17 12,694,140 (GRCm38) missense probably benign 0.17
R9666:Igf2r UTSW 17 12,726,701 (GRCm38) missense probably benign
X0028:Igf2r UTSW 17 12,704,913 (GRCm38) nonsense probably null
Z1177:Igf2r UTSW 17 12,697,399 (GRCm38) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCATATGGGAATCAATCACC -3'
(R):5'- TGATTCACAGGACATCAGGGAC -3'

Sequencing Primer
(F):5'- TATGGGAATCAATCACCAAGACC -3'
(R):5'- GACACATTGATGCTTGAGCC -3'
Posted On 2020-06-30