Mutagenetix > Incidental Mutation

Incidental Mutation 'R8138:Igf2r'

632379

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent

MMRRC Submission

067566-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.919) question?

Stock #

R8138 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12682406-12769664 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 12701238 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1405 (S1405T)

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599]

AlphaFold

Q07113

Predicted Effect

probably benign
Transcript: ENSMUST00000024599
AA Change: S1405T

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: S1405T

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000124664
Gene: ENSMUSG00000023830
AA Change: S14T

Domain	Start	End	E-Value	Type
Pfam:CIMR	1	65	3.1e-24	PFAM
Pfam:CIMR	68	129	6.1e-15	PFAM

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.9%
20x: 96.5%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abat	A	G	16: 8,600,965 (GRCm38)	D141G	probably benign	Het
Abcc1	A	G	16: 14,472,887 (GRCm38)	T1454A	probably damaging	Het
Acan	C	A	7: 79,098,427 (GRCm38)	T982N	probably benign	Het
Adam5	A	G	8: 24,781,762 (GRCm38)	L543P	probably damaging	Het
Akap13	T	A	7: 75,702,231 (GRCm38)		probably null	Het
Akirin1	G	A	4: 123,743,445 (GRCm38)	P116S	probably benign	Het
Bzw2	T	C	12: 36,109,820 (GRCm38)	D236G	probably benign	Het
C1qtnf2	G	A	11: 43,486,011 (GRCm38)	G70D	probably damaging	Het
Cd44	A	G	2: 102,832,497 (GRCm38)	I566T	probably benign	Het
Cltb	C	T	13: 54,598,783 (GRCm38)	D135N	possibly damaging	Het
Cpeb2	T	C	5: 43,235,009 (GRCm38)	V516A		Het
Cx3cr1	A	T	9: 120,051,583 (GRCm38)	M251K	possibly damaging	Het
Ect2l	A	T	10: 18,169,405 (GRCm38)	S301T	probably damaging	Het
Fgd6	A	G	10: 94,134,143 (GRCm38)	K1218R	probably null	Het
Fsip2	T	C	2: 82,975,797 (GRCm38)	V820A	possibly damaging	Het
Gnas	A	G	2: 174,298,386 (GRCm38)	E116G	probably benign	Het
Greb1l	T	C	18: 10,533,060 (GRCm38)	Y985H	probably benign	Het
Gtpbp3	T	C	8: 71,492,598 (GRCm38)	L438P	probably damaging	Het
Habp4	A	G	13: 64,176,070 (GRCm38)	D269G	possibly damaging	Het
Il17rc	A	G	6: 113,482,539 (GRCm38)	D482G	probably damaging	Het
Kmt2d	A	G	15: 98,843,653 (GRCm38)	I4542T	unknown	Het
Lag3	A	G	6: 124,905,492 (GRCm38)	V347A	probably damaging	Het
Lmtk2	C	T	5: 144,175,597 (GRCm38)	S1045L	probably damaging	Het
Mblac2	A	G	13: 81,711,650 (GRCm38)	D41G	probably damaging	Het
Mfsd6	C	T	1: 52,709,512 (GRCm38)	V65I	probably benign	Het
Neb	A	G	2: 52,175,695 (GRCm38)	V6175A	possibly damaging	Het
Nin	A	G	12: 70,042,898 (GRCm38)	S1248P		Het
Nlrp4b	A	T	7: 10,715,531 (GRCm38)	M554L	probably benign	Het
Olfr1055	T	C	2: 86,347,586 (GRCm38)	Y60C	possibly damaging	Het
Olfr235	G	A	19: 12,269,072 (GRCm38)	V281M	possibly damaging	Het
Olfr483	A	T	7: 108,103,557 (GRCm38)	S83C	possibly damaging	Het
Olfr613	T	A	7: 103,552,059 (GRCm38)	H91Q	probably benign	Het
Pik3r4	C	A	9: 105,669,035 (GRCm38)	S861R	possibly damaging	Het
Ppp1r16a	T	C	15: 76,691,721 (GRCm38)	V95A	probably damaging	Het
Prss40	T	C	1: 34,557,999 (GRCm38)	Q156R	probably damaging	Het
Rhbdd3	CACCATGGCTGCTACCATGGCTGCT	CACCATGGCTGCT	11: 5,104,303 (GRCm38)		probably benign	Het
Rnf170	T	C	8: 26,125,981 (GRCm38)		probably null	Het
Smlr1	A	G	10: 25,536,041 (GRCm38)	V16A	probably benign	Het
Sowahb	A	G	5: 93,043,483 (GRCm38)	L459P	probably benign	Het
Srebf2	C	T	15: 82,178,765 (GRCm38)	R468C	probably damaging	Het
Tpo	T	C	12: 30,074,104 (GRCm38)	D899G	probably benign	Het
Traj7	C	T	14: 54,211,525 (GRCm38)	P19S		Het
Trit1	G	A	4: 123,043,789 (GRCm38)	W131*	probably null	Het
Vcpip1	GGGAGGCGGCGGCGGCGGCAGCGGAGGAGGCGGCGGCGGC	GGGAGGAGGCGGCGGCGGC	1: 9,748,109 (GRCm38)		probably benign	Het
Vmn1r4	A	G	6: 56,957,406 (GRCm38)	*298W	probably null	Het
Vmn2r124	T	A	17: 18,063,348 (GRCm38)	W435R	probably damaging	Het
Zbtb41	C	T	1: 139,441,807 (GRCm38)	R641C	probably damaging	Het
Zfp84	T	A	7: 29,775,372 (GRCm38)	F23Y	probably damaging	Het
Zfp879	G	T	11: 50,833,448 (GRCm38)	Y260*	probably null	Het
Zswim9	A	T	7: 13,261,411 (GRCm38)	F273Y	probably damaging	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12,713,990 (GRCm38)	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12,739,328 (GRCm38)	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12,700,358 (GRCm38)	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12,683,867 (GRCm38)	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12,704,775 (GRCm38)	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12,695,374 (GRCm38)	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12,704,349 (GRCm38)	missense	probably benign
IGL01557:Igf2r	APN	17	12,704,635 (GRCm38)	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12,683,985 (GRCm38)	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12,725,415 (GRCm38)	nonsense	probably null
IGL01720:Igf2r	APN	17	12,701,313 (GRCm38)	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12,683,822 (GRCm38)	missense	probably benign
IGL01839:Igf2r	APN	17	12,705,022 (GRCm38)	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12,714,911 (GRCm38)	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12,704,338 (GRCm38)	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12,693,192 (GRCm38)	nonsense	probably null
IGL02095:Igf2r	APN	17	12,702,005 (GRCm38)	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12,698,516 (GRCm38)	unclassified	probably benign
IGL02576:Igf2r	APN	17	12,748,763 (GRCm38)	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12,712,087 (GRCm38)	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12,719,883 (GRCm38)	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12,692,723 (GRCm38)	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12,694,120 (GRCm38)	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12,710,746 (GRCm38)	splice site	probably benign
IGL03080:Igf2r	APN	17	12,726,676 (GRCm38)	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12,716,672 (GRCm38)	missense	probably damaging	1.00
blunt	UTSW	17	12,722,175 (GRCm38)	missense	probably benign	0.02
brusque	UTSW	17	12,714,951 (GRCm38)	missense	probably damaging	0.98
gruff	UTSW	17	12,684,097 (GRCm38)	missense	probably damaging	0.96
outlier	UTSW	17	12,695,314 (GRCm38)	missense	probably benign	0.20
NA:Igf2r	UTSW	17	12,691,962 (GRCm38)	missense	probably benign
R0165:Igf2r	UTSW	17	12,698,527 (GRCm38)	missense	probably benign	0.07
R0412:Igf2r	UTSW	17	12,683,948 (GRCm38)	missense	probably damaging	0.98
R0523:Igf2r	UTSW	17	12,692,064 (GRCm38)	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12,717,274 (GRCm38)	splice site	probably null
R0722:Igf2r	UTSW	17	12,715,495 (GRCm38)	critical splice acceptor site	probably null
R0894:Igf2r	UTSW	17	12,692,101 (GRCm38)	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12,694,124 (GRCm38)	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12,717,269 (GRCm38)	splice site	probably benign
R1485:Igf2r	UTSW	17	12,691,285 (GRCm38)	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12,726,309 (GRCm38)	missense	probably benign
R1693:Igf2r	UTSW	17	12,704,316 (GRCm38)	missense	probably damaging	0.97
R1751:Igf2r	UTSW	17	12,697,441 (GRCm38)	missense	possibly damaging	0.94
R1843:Igf2r	UTSW	17	12,704,270 (GRCm38)	critical splice donor site	probably null
R1981:Igf2r	UTSW	17	12,733,903 (GRCm38)	nonsense	probably null
R1994:Igf2r	UTSW	17	12,692,738 (GRCm38)	missense	probably benign
R2060:Igf2r	UTSW	17	12,701,319 (GRCm38)	missense	possibly damaging	0.92
R2108:Igf2r	UTSW	17	12,698,251 (GRCm38)	missense	probably benign	0.02
R2132:Igf2r	UTSW	17	12,722,208 (GRCm38)	missense	probably benign	0.12
R2314:Igf2r	UTSW	17	12,715,943 (GRCm38)	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12,722,311 (GRCm38)	splice site	probably null
R2696:Igf2r	UTSW	17	12,695,344 (GRCm38)	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12,686,724 (GRCm38)	missense	probably damaging	0.99
R2865:Igf2r	UTSW	17	12,686,724 (GRCm38)	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12,709,468 (GRCm38)	missense	probably benign
R3930:Igf2r	UTSW	17	12,705,829 (GRCm38)	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12,748,751 (GRCm38)	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12,702,254 (GRCm38)	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12,709,511 (GRCm38)	missense	possibly damaging	0.95
R4343:Igf2r	UTSW	17	12,709,511 (GRCm38)	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12,709,511 (GRCm38)	missense	possibly damaging	0.95
R4760:Igf2r	UTSW	17	12,703,465 (GRCm38)	missense	possibly damaging	0.92
R4796:Igf2r	UTSW	17	12,684,126 (GRCm38)	missense	possibly damaging	0.70
R4816:Igf2r	UTSW	17	12,684,097 (GRCm38)	missense	probably damaging	0.96
R4826:Igf2r	UTSW	17	12,701,353 (GRCm38)	missense	probably damaging	0.98
R4933:Igf2r	UTSW	17	12,691,877 (GRCm38)	splice site	probably null
R4980:Igf2r	UTSW	17	12,703,360 (GRCm38)	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12,725,416 (GRCm38)	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12,695,314 (GRCm38)	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12,693,145 (GRCm38)	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12,739,334 (GRCm38)	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12,717,367 (GRCm38)	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12,698,352 (GRCm38)	splice site	probably null
R5794:Igf2r	UTSW	17	12,709,445 (GRCm38)	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12,714,951 (GRCm38)	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12,714,113 (GRCm38)	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12,683,900 (GRCm38)	missense	probably benign
R6396:Igf2r	UTSW	17	12,714,090 (GRCm38)	missense	probably benign	0.00
R6584:Igf2r	UTSW	17	12,701,250 (GRCm38)	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12,691,937 (GRCm38)	nonsense	probably null
R6591:Igf2r	UTSW	17	12,689,008 (GRCm38)	missense	probably damaging	1.00
R6599:Igf2r	UTSW	17	12,698,618 (GRCm38)	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12,691,937 (GRCm38)	nonsense	probably null
R6691:Igf2r	UTSW	17	12,689,008 (GRCm38)	missense	probably damaging	1.00
R6752:Igf2r	UTSW	17	12,714,944 (GRCm38)	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12,714,082 (GRCm38)	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12,703,376 (GRCm38)	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12,697,341 (GRCm38)	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12,718,718 (GRCm38)	missense	probably benign
R7030:Igf2r	UTSW	17	12,733,866 (GRCm38)	missense	probably damaging	1.00
R7038:Igf2r	UTSW	17	12,698,325 (GRCm38)	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12,704,323 (GRCm38)	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12,714,116 (GRCm38)	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12,703,484 (GRCm38)	missense	probably damaging	0.99
R7413:Igf2r	UTSW	17	12,698,228 (GRCm38)	nonsense	probably null
R7463:Igf2r	UTSW	17	12,710,645 (GRCm38)	missense	probably benign	0.16
R7619:Igf2r	UTSW	17	12,698,273 (GRCm38)	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12,735,991 (GRCm38)	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12,739,369 (GRCm38)	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12,748,704 (GRCm38)	missense	probably benign
R8022:Igf2r	UTSW	17	12,718,795 (GRCm38)	missense	probably damaging	1.00
R8220:Igf2r	UTSW	17	12,692,071 (GRCm38)	missense	probably benign	0.22
R8305:Igf2r	UTSW	17	12,733,860 (GRCm38)	missense	probably benign
R8359:Igf2r	UTSW	17	12,683,861 (GRCm38)	missense	probably benign
R8500:Igf2r	UTSW	17	12,709,441 (GRCm38)	missense	probably damaging	0.99
R8510:Igf2r	UTSW	17	12,704,313 (GRCm38)	missense	probably benign	0.38
R8933:Igf2r	UTSW	17	12,704,637 (GRCm38)	missense	probably damaging	1.00
R8933:Igf2r	UTSW	17	12,701,244 (GRCm38)	missense	probably damaging	0.97
R8976:Igf2r	UTSW	17	12,726,772 (GRCm38)	missense	probably damaging	1.00
R8994:Igf2r	UTSW	17	12,716,650 (GRCm38)	missense	possibly damaging	0.87
R9059:Igf2r	UTSW	17	12,751,293 (GRCm38)	start codon destroyed	probably null
R9097:Igf2r	UTSW	17	12,691,213 (GRCm38)	missense	probably damaging	1.00
R9127:Igf2r	UTSW	17	12,739,351 (GRCm38)	missense	probably damaging	0.98
R9278:Igf2r	UTSW	17	12,695,353 (GRCm38)	missense	probably damaging	1.00
R9362:Igf2r	UTSW	17	12,722,175 (GRCm38)	missense	probably benign	0.02
R9371:Igf2r	UTSW	17	12,705,759 (GRCm38)	missense	possibly damaging	0.93
R9522:Igf2r	UTSW	17	12,698,328 (GRCm38)	missense	probably benign	0.26
R9567:Igf2r	UTSW	17	12,686,754 (GRCm38)	missense	probably damaging	1.00
R9665:Igf2r	UTSW	17	12,694,140 (GRCm38)	missense	probably benign	0.17
R9666:Igf2r	UTSW	17	12,726,701 (GRCm38)	missense	probably benign
X0028:Igf2r	UTSW	17	12,704,913 (GRCm38)	nonsense	probably null
Z1177:Igf2r	UTSW	17	12,697,399 (GRCm38)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGCCATATGGGAATCAATCACC -3'
(R):5'- TGATTCACAGGACATCAGGGAC -3'

Sequencing Primer
(F):5'- TATGGGAATCAATCACCAAGACC -3'
(R):5'- GACACATTGATGCTTGAGCC -3'

Posted On

2020-06-30