Incidental Mutation 'R8138:Vmn2r124'
ID632380
Institutional Source Beutler Lab
Gene Symbol Vmn2r124
Ensembl Gene ENSMUSG00000094396
Gene Namevomeronasal 2, receptor 124
SynonymsGm7196, Vmn2r-ps113
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R8138 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location18049424-18079732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18063348 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 435 (W435R)
Ref Sequence ENSEMBL: ENSMUSP00000135613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176802] [ENSMUST00000231546]
Predicted Effect probably damaging
Transcript: ENSMUST00000176802
AA Change: W435R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135613
Gene: ENSMUSG00000094396
AA Change: W435R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 84 449 2.2e-37 PFAM
Pfam:NCD3G 510 563 9.3e-21 PFAM
Pfam:7tm_3 596 831 1.6e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231546
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.5%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat A G 16: 8,600,965 D141G probably benign Het
Abcc1 A G 16: 14,472,887 T1454A probably damaging Het
Acan C A 7: 79,098,427 T982N probably benign Het
Adam5 A G 8: 24,781,762 L543P probably damaging Het
Akap13 T A 7: 75,702,231 probably null Het
Akirin1 G A 4: 123,743,445 P116S probably benign Het
Bzw2 T C 12: 36,109,820 D236G probably benign Het
C1qtnf2 G A 11: 43,486,011 G70D probably damaging Het
Cd44 A G 2: 102,832,497 I566T probably benign Het
Cltb C T 13: 54,598,783 D135N possibly damaging Het
Cpeb2 T C 5: 43,235,009 V516A Het
Cx3cr1 A T 9: 120,051,583 M251K possibly damaging Het
Ect2l A T 10: 18,169,405 S301T probably damaging Het
Fgd6 A G 10: 94,134,143 K1218R probably null Het
Fsip2 T C 2: 82,975,797 V820A possibly damaging Het
Gnas A G 2: 174,298,386 E116G probably benign Het
Greb1l T C 18: 10,533,060 Y985H probably benign Het
Gtpbp3 T C 8: 71,492,598 L438P probably damaging Het
Habp4 A G 13: 64,176,070 D269G possibly damaging Het
Igf2r A T 17: 12,701,238 S1405T probably benign Het
Il17rc A G 6: 113,482,539 D482G probably damaging Het
Kmt2d A G 15: 98,843,653 I4542T unknown Het
Lag3 A G 6: 124,905,492 V347A probably damaging Het
Lmtk2 C T 5: 144,175,597 S1045L probably damaging Het
Mblac2 A G 13: 81,711,650 D41G probably damaging Het
Mfsd6 C T 1: 52,709,512 V65I probably benign Het
Neb A G 2: 52,175,695 V6175A possibly damaging Het
Nin A G 12: 70,042,898 S1248P Het
Nlrp4b A T 7: 10,715,531 M554L probably benign Het
Olfr1055 T C 2: 86,347,586 Y60C possibly damaging Het
Olfr235 G A 19: 12,269,072 V281M possibly damaging Het
Olfr483 A T 7: 108,103,557 S83C possibly damaging Het
Olfr613 T A 7: 103,552,059 H91Q probably benign Het
Pik3r4 C A 9: 105,669,035 S861R possibly damaging Het
Ppp1r16a T C 15: 76,691,721 V95A probably damaging Het
Prss40 T C 1: 34,557,999 Q156R probably damaging Het
Rhbdd3 CACCATGGCTGCTACCATGGCTGCT CACCATGGCTGCT 11: 5,104,303 probably benign Het
Rnf170 T C 8: 26,125,981 probably null Het
Smlr1 A G 10: 25,536,041 V16A probably benign Het
Sowahb A G 5: 93,043,483 L459P probably benign Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Tpo T C 12: 30,074,104 D899G probably benign Het
Traj7 C T 14: 54,211,525 P19S Het
Trit1 G A 4: 123,043,789 W131* probably null Het
Vcpip1 GGGAGGCGGCGGCGGCGGCAGCGGAGGAGGCGGCGGCGGC GGGAGGAGGCGGCGGCGGC 1: 9,748,109 probably benign Het
Vmn1r4 A G 6: 56,957,406 *298W probably null Het
Zbtb41 C T 1: 139,441,807 R641C probably damaging Het
Zfp84 T A 7: 29,775,372 F23Y probably damaging Het
Zfp879 G T 11: 50,833,448 Y260* probably null Het
Zswim9 A T 7: 13,261,411 F273Y probably damaging Het
Other mutations in Vmn2r124
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Vmn2r124 APN 17 18062670 missense probably benign 0.04
IGL01356:Vmn2r124 APN 17 18073471 missense probably benign 0.08
IGL01387:Vmn2r124 APN 17 18062926 missense probably damaging 0.98
IGL01413:Vmn2r124 APN 17 18062565 missense probably benign 0.41
IGL01550:Vmn2r124 APN 17 18063355 critical splice donor site probably null
IGL01759:Vmn2r124 APN 17 18064068 missense probably benign 0.00
IGL01762:Vmn2r124 APN 17 18063172 missense possibly damaging 0.51
IGL02132:Vmn2r124 APN 17 18064229 splice site probably benign
IGL02290:Vmn2r124 APN 17 18073335 missense probably benign 0.09
IGL02370:Vmn2r124 APN 17 18064191 missense probably benign 0.14
IGL02527:Vmn2r124 APN 17 18066502 critical splice acceptor site probably null
PIT4280001:Vmn2r124 UTSW 17 18063225 missense probably benign 0.22
PIT4514001:Vmn2r124 UTSW 17 18073712 missense probably benign 0.01
R0362:Vmn2r124 UTSW 17 18064224 critical splice donor site probably null
R0401:Vmn2r124 UTSW 17 18064145 missense probably damaging 0.99
R0513:Vmn2r124 UTSW 17 18073729 missense possibly damaging 0.89
R1139:Vmn2r124 UTSW 17 18073790 missense possibly damaging 0.56
R1513:Vmn2r124 UTSW 17 18063273 missense probably damaging 1.00
R1669:Vmn2r124 UTSW 17 18062944 missense possibly damaging 0.94
R1710:Vmn2r124 UTSW 17 18061925 splice site probably benign
R1852:Vmn2r124 UTSW 17 18063174 missense probably benign
R1860:Vmn2r124 UTSW 17 18049497 missense probably benign 0.11
R1953:Vmn2r124 UTSW 17 18062860 missense probably benign 0.08
R2233:Vmn2r124 UTSW 17 18049665 missense possibly damaging 0.95
R2234:Vmn2r124 UTSW 17 18049665 missense possibly damaging 0.95
R2235:Vmn2r124 UTSW 17 18049665 missense possibly damaging 0.95
R2397:Vmn2r124 UTSW 17 18049597 missense possibly damaging 0.95
R2519:Vmn2r124 UTSW 17 18074018 missense probably damaging 1.00
R3845:Vmn2r124 UTSW 17 18073691 missense possibly damaging 0.90
R3846:Vmn2r124 UTSW 17 18073691 missense possibly damaging 0.90
R4594:Vmn2r124 UTSW 17 18073969 missense probably damaging 1.00
R4612:Vmn2r124 UTSW 17 18063022 missense probably benign 0.12
R4790:Vmn2r124 UTSW 17 18049593 missense probably damaging 1.00
R4809:Vmn2r124 UTSW 17 18073745 missense probably benign 0.00
R5227:Vmn2r124 UTSW 17 18049557 missense possibly damaging 0.95
R5254:Vmn2r124 UTSW 17 18063077 missense probably benign 0.00
R5609:Vmn2r124 UTSW 17 18073840 missense probably benign
R6145:Vmn2r124 UTSW 17 18062851 missense probably benign 0.05
R6181:Vmn2r124 UTSW 17 18073757 missense possibly damaging 0.93
R6271:Vmn2r124 UTSW 17 18062883 missense probably benign 0.01
R7297:Vmn2r124 UTSW 17 18073573 missense probably damaging 1.00
R7397:Vmn2r124 UTSW 17 18062685 missense probably damaging 1.00
R7406:Vmn2r124 UTSW 17 18062044 missense unknown
R7699:Vmn2r124 UTSW 17 18073723 missense probably benign 0.00
R7859:Vmn2r124 UTSW 17 18061950 missense probably damaging 1.00
R8121:Vmn2r124 UTSW 17 18062171 missense probably benign
R8756:Vmn2r124 UTSW 17 18073832 missense probably benign 0.08
R8796:Vmn2r124 UTSW 17 18062671 missense possibly damaging 0.95
R8841:Vmn2r124 UTSW 17 18063037 missense
R8960:Vmn2r124 UTSW 17 18063029 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTCCTAAGCTGTGGCATTTG -3'
(R):5'- TTTGACTAAGCATTTTGGCTCC -3'

Sequencing Primer
(F):5'- AGCTGTCATGCTTTGGACAAC -3'
(R):5'- GACTAAGCATTTTGGCTCCTAGTATC -3'
Posted On2020-06-30