Incidental Mutation 'R8138:Greb1l'
ID 632381
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Name growth regulation by estrogen in breast cancer-like
Synonyms AK220484, mKIAA4095
MMRRC Submission
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8138 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 10325177-10562934 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 10533060 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 985 (Y985H)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]
AlphaFold B9EJV3
Predicted Effect probably benign
Transcript: ENSMUST00000048977
AA Change: Y985H

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: Y985H

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172532
AA Change: Y876H

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: Y876H

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.5%
Validation Efficiency 98% (52/53)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat A G 16: 8,600,965 D141G probably benign Het
Abcc1 A G 16: 14,472,887 T1454A probably damaging Het
Acan C A 7: 79,098,427 T982N probably benign Het
Adam5 A G 8: 24,781,762 L543P probably damaging Het
Akap13 T A 7: 75,702,231 probably null Het
Akirin1 G A 4: 123,743,445 P116S probably benign Het
Bzw2 T C 12: 36,109,820 D236G probably benign Het
C1qtnf2 G A 11: 43,486,011 G70D probably damaging Het
Cd44 A G 2: 102,832,497 I566T probably benign Het
Cltb C T 13: 54,598,783 D135N possibly damaging Het
Cpeb2 T C 5: 43,235,009 V516A Het
Cx3cr1 A T 9: 120,051,583 M251K possibly damaging Het
Ect2l A T 10: 18,169,405 S301T probably damaging Het
Fgd6 A G 10: 94,134,143 K1218R probably null Het
Fsip2 T C 2: 82,975,797 V820A possibly damaging Het
Gnas A G 2: 174,298,386 E116G probably benign Het
Gtpbp3 T C 8: 71,492,598 L438P probably damaging Het
Habp4 A G 13: 64,176,070 D269G possibly damaging Het
Igf2r A T 17: 12,701,238 S1405T probably benign Het
Il17rc A G 6: 113,482,539 D482G probably damaging Het
Kmt2d A G 15: 98,843,653 I4542T unknown Het
Lag3 A G 6: 124,905,492 V347A probably damaging Het
Lmtk2 C T 5: 144,175,597 S1045L probably damaging Het
Mblac2 A G 13: 81,711,650 D41G probably damaging Het
Mfsd6 C T 1: 52,709,512 V65I probably benign Het
Neb A G 2: 52,175,695 V6175A possibly damaging Het
Nin A G 12: 70,042,898 S1248P Het
Nlrp4b A T 7: 10,715,531 M554L probably benign Het
Olfr1055 T C 2: 86,347,586 Y60C possibly damaging Het
Olfr235 G A 19: 12,269,072 V281M possibly damaging Het
Olfr483 A T 7: 108,103,557 S83C possibly damaging Het
Olfr613 T A 7: 103,552,059 H91Q probably benign Het
Pik3r4 C A 9: 105,669,035 S861R possibly damaging Het
Ppp1r16a T C 15: 76,691,721 V95A probably damaging Het
Prss40 T C 1: 34,557,999 Q156R probably damaging Het
Rhbdd3 CACCATGGCTGCTACCATGGCTGCT CACCATGGCTGCT 11: 5,104,303 probably benign Het
Rnf170 T C 8: 26,125,981 probably null Het
Smlr1 A G 10: 25,536,041 V16A probably benign Het
Sowahb A G 5: 93,043,483 L459P probably benign Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Tpo T C 12: 30,074,104 D899G probably benign Het
Traj7 C T 14: 54,211,525 P19S Het
Trit1 G A 4: 123,043,789 W131* probably null Het
Vcpip1 GGGAGGCGGCGGCGGCGGCAGCGGAGGAGGCGGCGGCGGC GGGAGGAGGCGGCGGCGGC 1: 9,748,109 probably benign Het
Vmn1r4 A G 6: 56,957,406 *298W probably null Het
Vmn2r124 T A 17: 18,063,348 W435R probably damaging Het
Zbtb41 C T 1: 139,441,807 R641C probably damaging Het
Zfp84 T A 7: 29,775,372 F23Y probably damaging Het
Zfp879 G T 11: 50,833,448 Y260* probably null Het
Zswim9 A T 7: 13,261,411 F273Y probably damaging Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R7934:Greb1l UTSW 18 10474371 nonsense probably null
R8137:Greb1l UTSW 18 10474357 missense possibly damaging 0.77
R8208:Greb1l UTSW 18 10510703 missense probably damaging 1.00
R8227:Greb1l UTSW 18 10515371 missense probably damaging 1.00
R8312:Greb1l UTSW 18 10511587 intron probably benign
R8331:Greb1l UTSW 18 10458706 missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10529687 missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10529613 missense probably benign 0.00
R8695:Greb1l UTSW 18 10544450 missense probably benign 0.01
R8795:Greb1l UTSW 18 10553739 missense probably damaging 0.98
R8836:Greb1l UTSW 18 10509257 missense probably benign 0.30
R8862:Greb1l UTSW 18 10555042 missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10529684 missense probably benign 0.18
R8874:Greb1l UTSW 18 10544896 missense probably benign 0.01
R8886:Greb1l UTSW 18 10553843 missense probably benign 0.21
R8921:Greb1l UTSW 18 10541825 missense probably benign 0.01
R8997:Greb1l UTSW 18 10510747 missense probably damaging 1.00
R9015:Greb1l UTSW 18 10541675 missense probably benign 0.00
R9018:Greb1l UTSW 18 10542004 missense possibly damaging 0.76
R9074:Greb1l UTSW 18 10532797 missense probably damaging 1.00
R9074:Greb1l UTSW 18 10558795 missense probably damaging 1.00
R9117:Greb1l UTSW 18 10542422 missense probably benign 0.31
R9189:Greb1l UTSW 18 10499983 missense probably benign
R9332:Greb1l UTSW 18 10532796 missense possibly damaging 0.92
R9367:Greb1l UTSW 18 10522130 missense probably benign 0.00
R9497:Greb1l UTSW 18 10458600 missense probably benign 0.00
Z1176:Greb1l UTSW 18 10515305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTACTCGGAGGCCTTGATG -3'
(R):5'- TTTAGCTTAGCCTGGCCAG -3'

Sequencing Primer
(F):5'- GATGGCTCTCACCACTATGG -3'
(R):5'- CTGGCCAGGGAGGTGAAAGTC -3'
Posted On 2020-06-30