Incidental Mutation 'R8139:Irs1'
ID 632384
Institutional Source Beutler Lab
Gene Symbol Irs1
Ensembl Gene ENSMUSG00000055980
Gene Name insulin receptor substrate 1
Synonyms G972R, IRS-1
MMRRC Submission 067567-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.558) question?
Stock # R8139 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 82210822-82269137 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 82267460 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 252 (M252K)
Ref Sequence ENSEMBL: ENSMUSP00000063795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069799]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000069799
AA Change: M252K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: M252K

DomainStartEndE-ValueType
PH 13 117 8.13e-14 SMART
low complexity region 123 143 N/A INTRINSIC
IRS 155 257 1.19e-35 SMART
PTBI 155 257 7.8e-60 SMART
low complexity region 263 276 N/A INTRINSIC
low complexity region 378 399 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
low complexity region 662 689 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
low complexity region 824 837 N/A INTRINSIC
low complexity region 1019 1040 N/A INTRINSIC
low complexity region 1051 1062 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1185 1200 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G T X: 69,438,120 (GRCm39) Q58K possibly damaging Het
Aamdc T C 7: 97,214,450 (GRCm39) M42V probably benign Het
Abca6 T A 11: 110,074,959 (GRCm39) Q1368L probably damaging Het
Best3 G A 10: 116,840,331 (GRCm39) G254R probably damaging Het
Cacna1h A T 17: 25,602,697 (GRCm39) I1478N probably damaging Het
Ccdc113 T A 8: 96,285,366 (GRCm39) M350K possibly damaging Het
Cdc42bpa A T 1: 179,896,884 (GRCm39) H389L probably damaging Het
Cnn3 G T 3: 121,248,718 (GRCm39) M208I probably damaging Het
Col11a1 A G 3: 113,890,698 (GRCm39) D345G unknown Het
Degs1l A G 1: 180,882,358 (GRCm39) D40G probably damaging Het
Dnah14 G T 1: 181,582,853 (GRCm39) V3131F probably damaging Het
Dst T A 1: 34,230,933 (GRCm39) M2842K probably benign Het
Dus3l C T 17: 57,074,058 (GRCm39) Q211* probably null Het
Eftud2 A G 11: 102,758,685 (GRCm39) F171S probably benign Het
Elac2 T C 11: 64,871,440 (GRCm39) I117T probably benign Het
Fam13b A G 18: 34,606,686 (GRCm39) C302R possibly damaging Het
Fbxl5 G A 5: 43,916,087 (GRCm39) Q442* probably null Het
Fhdc1 A G 3: 84,358,790 (GRCm39) S370P probably damaging Het
Gtf3c6 T C 10: 40,133,469 (GRCm39) probably null Het
I830077J02Rik A G 3: 105,835,314 (GRCm39) V21A probably benign Het
Inf2 G T 12: 112,568,074 (GRCm39) E209* probably null Het
Irag1 A G 7: 110,498,879 (GRCm39) probably null Het
Kcng3 C A 17: 83,938,516 (GRCm39) V178L probably damaging Het
Kif16b A C 2: 142,743,285 (GRCm39) S3A probably benign Het
Kit T C 5: 75,813,465 (GRCm39) M884T probably damaging Het
Kmt2a A T 9: 44,730,587 (GRCm39) probably benign Het
Kptn T C 7: 15,857,901 (GRCm39) I243T probably benign Het
Loxhd1 G A 18: 77,468,192 (GRCm39) E947K possibly damaging Het
Lyl1 A T 8: 85,429,476 (GRCm39) I62L probably damaging Het
Mmp24 C T 2: 155,655,965 (GRCm39) R468* probably null Het
Mtx2 G A 2: 74,706,714 (GRCm39) D230N probably benign Het
Ndufa5 A T 6: 24,522,757 (GRCm39) Y28* probably null Het
Notch4 G T 17: 34,803,774 (GRCm39) E1515* probably null Het
Nrxn3 A G 12: 90,171,438 (GRCm39) N923S probably benign Het
Ogfod2 C T 5: 124,251,538 (GRCm39) T116M possibly damaging Het
Oosp1 T C 19: 11,645,118 (GRCm39) E182G possibly damaging Het
Or4c115 A G 2: 88,928,187 (GRCm39) V28A probably benign Het
Or5p67 T A 7: 107,922,113 (GRCm39) T257S probably benign Het
Or7g20 A T 9: 18,946,871 (GRCm39) I151F probably benign Het
Or7g28 A C 9: 19,272,504 (GRCm39) V49G probably damaging Het
Oxnad1 C A 14: 31,814,048 (GRCm39) T47K possibly damaging Het
Pcdha5 A G 18: 37,095,791 (GRCm39) M767V possibly damaging Het
Pcnx3 A T 19: 5,715,773 (GRCm39) H1444Q probably benign Het
Pde4dip G T 3: 97,604,309 (GRCm39) Q2224K probably benign Het
Pgr A T 9: 8,956,341 (GRCm39) H763L possibly damaging Het
Plec T C 15: 76,058,510 (GRCm39) D3809G probably damaging Het
Ppfia1 A G 7: 144,074,430 (GRCm39) S155P probably damaging Het
Ppfia4 A G 1: 134,228,266 (GRCm39) V1090A probably benign Het
Ptgdr T C 14: 45,096,142 (GRCm39) E190G probably benign Het
Rhbdd2 T A 5: 135,665,189 (GRCm39) C173* probably null Het
Rhobtb1 C A 10: 69,102,120 (GRCm39) P134T probably damaging Het
Slc25a36 A T 9: 96,962,505 (GRCm39) F161L probably benign Het
Slc5a11 A G 7: 122,869,199 (GRCm39) T596A probably benign Het
Slco1a6 T C 6: 142,035,626 (GRCm39) Y566C probably damaging Het
Snx15 T G 19: 6,169,945 (GRCm39) K321T probably damaging Het
Snx15 T C 19: 6,169,946 (GRCm39) K321E probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Syt8 T C 7: 141,992,005 (GRCm39) I32T probably benign Het
Thumpd1 T C 7: 119,319,808 (GRCm39) N53D possibly damaging Het
Timm21 T C 18: 84,969,263 (GRCm39) T54A probably benign Het
Tmed10 A G 12: 85,391,091 (GRCm39) V149A probably damaging Het
Tmem108 T A 9: 103,377,084 (GRCm39) M122L probably benign Het
Tram1l1 A G 3: 124,115,436 (GRCm39) I199V probably benign Het
Tspan8 A G 10: 115,675,802 (GRCm39) N156S probably benign Het
Vamp9 A G 5: 100,072,785 (GRCm39) I111V probably benign Het
Vars1 T C 17: 35,230,480 (GRCm39) V521A probably benign Het
Vmn2r54 G T 7: 12,349,743 (GRCm39) T613N possibly damaging Het
Vps13b T A 15: 35,607,418 (GRCm39) L1117* probably null Het
Vps33a T C 5: 123,672,015 (GRCm39) K451R probably benign Het
Vsig10l T C 7: 43,113,153 (GRCm39) I35T probably benign Het
Xpnpep3 T A 15: 81,332,660 (GRCm39) L399Q probably damaging Het
Zfp438 T C 18: 5,214,013 (GRCm39) E315G probably benign Het
Zfp467 C T 6: 48,416,268 (GRCm39) G128D probably damaging Het
Other mutations in Irs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Irs1 APN 1 82,266,204 (GRCm39) missense probably benign 0.01
IGL00534:Irs1 APN 1 82,266,192 (GRCm39) missense probably benign
IGL01926:Irs1 APN 1 82,267,680 (GRCm39) missense probably damaging 0.98
IGL02130:Irs1 APN 1 82,267,188 (GRCm39) missense probably damaging 1.00
IGL03338:Irs1 APN 1 82,266,122 (GRCm39) missense probably benign 0.05
Hoverboard UTSW 1 82,267,819 (GRCm39) nonsense probably null
runt UTSW 1 82,265,453 (GRCm39) frame shift probably null
runt2 UTSW 1 82,264,688 (GRCm39) nonsense probably null
Sprite UTSW 1 82,265,830 (GRCm39) nonsense probably null
R0019:Irs1 UTSW 1 82,264,977 (GRCm39) nonsense probably null
R0063:Irs1 UTSW 1 82,266,580 (GRCm39) missense probably damaging 1.00
R0063:Irs1 UTSW 1 82,266,580 (GRCm39) missense probably damaging 1.00
R0318:Irs1 UTSW 1 82,266,381 (GRCm39) missense probably benign 0.01
R1199:Irs1 UTSW 1 82,267,347 (GRCm39) missense probably damaging 1.00
R1363:Irs1 UTSW 1 82,265,009 (GRCm39) missense probably benign 0.02
R1584:Irs1 UTSW 1 82,267,165 (GRCm39) missense probably benign 0.24
R1874:Irs1 UTSW 1 82,267,574 (GRCm39) frame shift probably null
R1903:Irs1 UTSW 1 82,267,182 (GRCm39) missense probably damaging 1.00
R1929:Irs1 UTSW 1 82,266,180 (GRCm39) missense probably benign
R1986:Irs1 UTSW 1 82,266,486 (GRCm39) missense probably damaging 1.00
R2136:Irs1 UTSW 1 82,267,763 (GRCm39) missense probably damaging 1.00
R2179:Irs1 UTSW 1 82,267,940 (GRCm39) missense possibly damaging 0.81
R2271:Irs1 UTSW 1 82,266,180 (GRCm39) missense probably benign
R2760:Irs1 UTSW 1 82,266,291 (GRCm39) missense probably damaging 1.00
R3721:Irs1 UTSW 1 82,267,806 (GRCm39) missense probably benign 0.11
R3821:Irs1 UTSW 1 82,267,770 (GRCm39) missense probably benign
R4306:Irs1 UTSW 1 82,265,685 (GRCm39) missense probably benign 0.11
R4420:Irs1 UTSW 1 82,266,171 (GRCm39) missense possibly damaging 0.94
R4451:Irs1 UTSW 1 82,266,749 (GRCm39) missense probably benign 0.00
R4479:Irs1 UTSW 1 82,265,015 (GRCm39) missense probably damaging 1.00
R4771:Irs1 UTSW 1 82,265,696 (GRCm39) missense probably benign 0.00
R4782:Irs1 UTSW 1 82,265,184 (GRCm39) missense probably benign 0.00
R4836:Irs1 UTSW 1 82,265,453 (GRCm39) frame shift probably null
R4880:Irs1 UTSW 1 82,265,453 (GRCm39) frame shift probably null
R4881:Irs1 UTSW 1 82,265,453 (GRCm39) frame shift probably null
R5031:Irs1 UTSW 1 82,264,688 (GRCm39) nonsense probably null
R5053:Irs1 UTSW 1 82,264,643 (GRCm39) missense probably benign
R5418:Irs1 UTSW 1 82,266,491 (GRCm39) missense probably damaging 1.00
R5595:Irs1 UTSW 1 82,267,646 (GRCm39) missense probably damaging 1.00
R5698:Irs1 UTSW 1 82,266,455 (GRCm39) missense probably benign 0.01
R6381:Irs1 UTSW 1 82,265,405 (GRCm39) missense possibly damaging 0.66
R6563:Irs1 UTSW 1 82,266,128 (GRCm39) missense probably damaging 0.98
R7002:Irs1 UTSW 1 82,265,981 (GRCm39) missense probably benign 0.13
R7095:Irs1 UTSW 1 82,267,819 (GRCm39) nonsense probably null
R7195:Irs1 UTSW 1 82,265,177 (GRCm39) missense probably benign 0.13
R7216:Irs1 UTSW 1 82,267,476 (GRCm39) missense probably damaging 0.98
R7361:Irs1 UTSW 1 82,266,835 (GRCm39) nonsense probably null
R7490:Irs1 UTSW 1 82,264,985 (GRCm39) missense probably damaging 0.99
R7540:Irs1 UTSW 1 82,265,723 (GRCm39) missense not run
R7706:Irs1 UTSW 1 82,265,412 (GRCm39) missense probably damaging 1.00
R7910:Irs1 UTSW 1 82,267,802 (GRCm39) missense probably benign 0.06
R7912:Irs1 UTSW 1 82,267,605 (GRCm39) missense probably benign
R7962:Irs1 UTSW 1 82,266,443 (GRCm39) missense possibly damaging 0.57
R8158:Irs1 UTSW 1 82,267,254 (GRCm39) missense probably damaging 1.00
R8159:Irs1 UTSW 1 82,266,290 (GRCm39) missense probably damaging 1.00
R8187:Irs1 UTSW 1 82,266,021 (GRCm39) missense probably damaging 1.00
R8288:Irs1 UTSW 1 82,265,682 (GRCm39) nonsense probably null
R8436:Irs1 UTSW 1 82,267,970 (GRCm39) missense possibly damaging 0.96
R8865:Irs1 UTSW 1 82,265,830 (GRCm39) nonsense probably null
R8950:Irs1 UTSW 1 82,264,652 (GRCm39) missense probably benign
R9591:Irs1 UTSW 1 82,265,969 (GRCm39) missense probably benign 0.00
X0063:Irs1 UTSW 1 82,266,629 (GRCm39) missense probably damaging 1.00
X0065:Irs1 UTSW 1 82,267,086 (GRCm39) missense probably damaging 1.00
Z1177:Irs1 UTSW 1 82,268,115 (GRCm39) missense probably benign 0.29
Z1177:Irs1 UTSW 1 82,266,717 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GAAGGAACCTGGTTTCCCAC -3'
(R):5'- CAAGACCATCAGCTTTGTGAAG -3'

Sequencing Primer
(F):5'- CACCATACTGGCAGGGGAG -3'
(R):5'- CTTTGTGAAGCTGAACTCCGAG -3'
Posted On 2020-06-30