Incidental Mutation 'R8139:Dnah14'
ID632388
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Namedynein, axonemal, heavy chain 14
SynonymsDnahc14, Gm980, LOC381311, A230079K17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R8139 (G1)
Quality Score210.009
Status Not validated
Chromosome1
Chromosomal Location181576559-181815774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 181755288 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 3131 (V3131F)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000208001
AA Change: V3131F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G T X: 70,394,514 Q58K possibly damaging Het
9130409I23Rik A G 1: 181,054,793 D40G probably damaging Het
Aamdc T C 7: 97,565,243 M42V probably benign Het
Abca6 T A 11: 110,184,133 Q1368L probably damaging Het
Best3 G A 10: 117,004,426 G254R probably damaging Het
Cacna1h A T 17: 25,383,723 I1478N probably damaging Het
Ccdc113 T A 8: 95,558,738 M350K possibly damaging Het
Cdc42bpa A T 1: 180,069,319 H389L probably damaging Het
Cnn3 G T 3: 121,455,069 M208I probably damaging Het
Col11a1 A G 3: 114,097,049 D345G unknown Het
Dst T A 1: 34,191,852 M2842K probably benign Het
Dus3l C T 17: 56,767,058 Q211* probably null Het
Eftud2 A G 11: 102,867,859 F171S probably benign Het
Elac2 T C 11: 64,980,614 I117T probably benign Het
Fam13b A G 18: 34,473,633 C302R possibly damaging Het
Fbxl5 G A 5: 43,758,745 Q442* probably null Het
Fhdc1 A G 3: 84,451,483 S370P probably damaging Het
Gm35911 A G 5: 99,924,926 I111V probably benign Het
I830077J02Rik A G 3: 105,927,998 V21A probably benign Het
Inf2 G T 12: 112,601,640 E209* probably null Het
Irs1 A T 1: 82,289,739 M252K probably damaging Het
Kcng3 C A 17: 83,631,087 V178L probably damaging Het
Kif16b A C 2: 142,901,365 S3A probably benign Het
Kit T C 5: 75,652,805 M884T probably damaging Het
Kmt2a A T 9: 44,819,290 probably benign Het
Kptn T C 7: 16,123,976 I243T probably benign Het
Loxhd1 G A 18: 77,380,496 E947K possibly damaging Het
Lyl1 A T 8: 84,702,847 I62L probably damaging Het
Mmp24 C T 2: 155,814,045 R468* probably null Het
Mrvi1 A G 7: 110,899,672 probably null Het
Mtx2 G A 2: 74,876,370 D230N probably benign Het
Ndufa5 A T 6: 24,522,758 Y28* probably null Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Nrxn3 A G 12: 90,204,664 N923S probably benign Het
Ogfod2 C T 5: 124,113,475 T116M possibly damaging Het
Olfr1220 A G 2: 89,097,843 V28A probably benign Het
Olfr492 T A 7: 108,322,906 T257S probably benign Het
Olfr835 A T 9: 19,035,575 I151F probably benign Het
Olfr846 A C 9: 19,361,208 V49G probably damaging Het
Oosp1 T C 19: 11,667,754 E182G possibly damaging Het
Oxnad1 C A 14: 32,092,091 T47K possibly damaging Het
Pcdha5 A G 18: 36,962,738 M767V possibly damaging Het
Pcnx3 A T 19: 5,665,745 H1444Q probably benign Het
Pde4dip G T 3: 97,696,993 Q2224K probably benign Het
Pgr A T 9: 8,956,340 H763L possibly damaging Het
Plec T C 15: 76,174,310 D3809G probably damaging Het
Ppfia1 A G 7: 144,520,693 S155P probably damaging Het
Ppfia4 A G 1: 134,300,528 V1090A probably benign Het
Ptgdr T C 14: 44,858,685 E190G probably benign Het
Rhbdd2 T A 5: 135,636,335 C173* probably null Het
Rhobtb1 C A 10: 69,266,290 P134T probably damaging Het
Slc25a36 A T 9: 97,080,452 F161L probably benign Het
Slc5a11 A G 7: 123,269,976 T596A probably benign Het
Slco1a6 T C 6: 142,089,900 Y566C probably damaging Het
Snx15 T G 19: 6,119,915 K321T probably damaging Het
Snx15 T C 19: 6,119,916 K321E probably damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Syt8 T C 7: 142,438,268 I32T probably benign Het
Thumpd1 T C 7: 119,720,585 N53D possibly damaging Het
Timm21 T C 18: 84,951,138 T54A probably benign Het
Tmed10 A G 12: 85,344,317 V149A probably damaging Het
Tmem108 T A 9: 103,499,885 M122L probably benign Het
Tram1l1 A G 3: 124,321,787 I199V probably benign Het
Tspan8 A G 10: 115,839,897 N156S probably benign Het
Vars T C 17: 35,011,504 V521A probably benign Het
Vmn2r54 G T 7: 12,615,816 T613N possibly damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Vps33a T C 5: 123,533,952 K451R probably benign Het
Vsig10l T C 7: 43,463,729 I35T probably benign Het
Xpnpep3 T A 15: 81,448,459 L399Q probably damaging Het
Zfp438 T C 18: 5,214,013 E315G probably benign Het
Zfp467 C T 6: 48,439,334 G128D probably damaging Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181752046 missense probably benign 0.17
IGL01764:Dnah14 APN 1 181744777 missense probably benign 0.00
IGL03218:Dnah14 APN 1 181755269 missense probably benign 0.02
IGL03290:Dnah14 APN 1 181763978 splice site probably benign
IGL03384:Dnah14 APN 1 181745949 missense probably benign 0.03
R0009:Dnah14 UTSW 1 181769407 splice site probably benign
R0125:Dnah14 UTSW 1 181752063 missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181744747 missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181750177 missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181763960 missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181752562 missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181755241 critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181757223 missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181757234 missense probably benign 0.01
R5424:Dnah14 UTSW 1 181763310 missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181741159 missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181770105 missense probably benign 0.00
R6052:Dnah14 UTSW 1 181666487 missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181709051 missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181750154 missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181621833 missense probably benign 0.13
R6145:Dnah14 UTSW 1 181666417 missense probably benign 0.00
R6163:Dnah14 UTSW 1 181666361 missense probably benign 0.33
R6246:Dnah14 UTSW 1 181680888 missense probably benign 0.00
R6302:Dnah14 UTSW 1 181601206 missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181585024 frame shift probably null
R6326:Dnah14 UTSW 1 181783556 missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181626720 missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181755386 splice site probably null
R6376:Dnah14 UTSW 1 181605894 missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181651202 critical splice donor site probably null
R6433:Dnah14 UTSW 1 181651657 missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181783705 missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181744768 missense probably benign 0.26
R6523:Dnah14 UTSW 1 181643621 missense probably benign 0.00
R6529:Dnah14 UTSW 1 181666469 missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181584985 missense unknown
R6546:Dnah14 UTSW 1 181738987 missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181593452 missense probably benign 0.07
R6762:Dnah14 UTSW 1 181757259 missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181641405 missense probably benign 0.21
R6849:Dnah14 UTSW 1 181808945 missense probably benign 0.00
R6877:Dnah14 UTSW 1 181628432 missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181750183 missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181585066 missense probably benign 0.04
R6924:Dnah14 UTSW 1 181627952 missense probably benign 0.04
R6957:Dnah14 UTSW 1 181785175 missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181648230 missense probably benign 0.00
R7018:Dnah14 UTSW 1 181626944 missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181623003 missense probably benign 0.01
R7058:Dnah14 UTSW 1 181698049 missense probably benign 0.00
R7068:Dnah14 UTSW 1 181769790 missense probably benign 0.35
R7115:Dnah14 UTSW 1 181720145 missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181745958 nonsense probably null
R7165:Dnah14 UTSW 1 181704535 missense probably benign 0.00
R7169:Dnah14 UTSW 1 181702365 missense probably benign 0.00
R7184:Dnah14 UTSW 1 181704529 nonsense probably null
R7232:Dnah14 UTSW 1 181757363 missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181706744 missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181685807 missense probably benign 0.41
R7290:Dnah14 UTSW 1 181628174 missense probably benign 0.20
R7314:Dnah14 UTSW 1 181785254 splice site probably null
R7326:Dnah14 UTSW 1 181598403 missense probably benign 0.02
R7336:Dnah14 UTSW 1 181797734 missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181690524 splice site probably null
R7371:Dnah14 UTSW 1 181626885 missense probably benign 0.05
R7376:Dnah14 UTSW 1 181763402 missense probably benign 0.03
R7418:Dnah14 UTSW 1 181616742 missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181752139 missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181628067 missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181770054 missense probably benign 0.26
R7641:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7663:Dnah14 UTSW 1 181752155 splice site probably null
R7674:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7680:Dnah14 UTSW 1 181685800 missense probably benign 0.15
R7709:Dnah14 UTSW 1 181702484 critical splice donor site probably null
R7842:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181616759 missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181783574 missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181648311 missense probably benign 0.05
R8042:Dnah14 UTSW 1 181643631 critical splice donor site probably null
R8071:Dnah14 UTSW 1 181615894 missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181766232 missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181806032 nonsense probably null
R8176:Dnah14 UTSW 1 181657033 missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181688205 missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181690101 missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181664865 missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181744792 missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181773811 missense probably benign 0.03
R8289:Dnah14 UTSW 1 181716215 nonsense probably null
R8323:Dnah14 UTSW 1 181704544 missense probably benign 0.01
RF007:Dnah14 UTSW 1 181685809 missense probably benign 0.00
RF012:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181757351 missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181690320 missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181763334 missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181766304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCACGCAATCCATGTGGGG -3'
(R):5'- TCCCTGAAAGGTTTCCCTGG -3'

Sequencing Primer
(F):5'- CAATCCATGTGGGGAGGTTTCC -3'
(R):5'- AAGCCATACCTTCTCGTC -3'
Posted On2020-06-30