Incidental Mutation 'R8139:Mmp24'
ID632392
Institutional Source Beutler Lab
Gene Symbol Mmp24
Ensembl Gene ENSMUSG00000027612
Gene Namematrix metallopeptidase 24
SynonymsMembrane type 5-MMP, MT5-MMP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R8139 (G1)
Quality Score136.008
Status Validated
Chromosome2
Chromosomal Location155775342-155818366 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 155814045 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 468 (R468*)
Ref Sequence ENSEMBL: ENSMUSP00000029141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029141] [ENSMUST00000124586]
Predicted Effect probably null
Transcript: ENSMUST00000029141
AA Change: R468*
SMART Domains Protein: ENSMUSP00000029141
Gene: ENSMUSG00000027612
AA Change: R468*

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:PG_binding_1 52 107 6.9e-14 PFAM
ZnMc 132 301 1.78e-60 SMART
low complexity region 323 346 N/A INTRINSIC
HX 357 400 7.4e-9 SMART
HX 402 446 7.01e-10 SMART
HX 449 495 6.49e-14 SMART
HX 497 542 6.64e-11 SMART
Pfam:DUF3377 548 618 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124586
SMART Domains Protein: ENSMUSP00000145349
Gene: ENSMUSG00000074649

DomainStartEndE-ValueType
low complexity region 7 37 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein do not develop neuropathic pain with mechanical allodynia after sciatic nerve injury, display enhanced sensitivity to noxious thermal stimuli under basal conditions, and develop hyperalgesia during inflammation. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene fail to develop neuropathic pain after peripheral nerve injury. They also experience reduced stress and enhanced mechanical coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G T X: 70,394,514 Q58K possibly damaging Het
9130409I23Rik A G 1: 181,054,793 D40G probably damaging Het
Aamdc T C 7: 97,565,243 M42V probably benign Het
Abca6 T A 11: 110,184,133 Q1368L probably damaging Het
Best3 G A 10: 117,004,426 G254R probably damaging Het
Cacna1h A T 17: 25,383,723 I1478N probably damaging Het
Ccdc113 T A 8: 95,558,738 M350K possibly damaging Het
Cdc42bpa A T 1: 180,069,319 H389L probably damaging Het
Cnn3 G T 3: 121,455,069 M208I probably damaging Het
Col11a1 A G 3: 114,097,049 D345G unknown Het
Dnah14 G T 1: 181,755,288 V3131F probably damaging Het
Dst T A 1: 34,191,852 M2842K probably benign Het
Dus3l C T 17: 56,767,058 Q211* probably null Het
Eftud2 A G 11: 102,867,859 F171S probably benign Het
Elac2 T C 11: 64,980,614 I117T probably benign Het
Fam13b A G 18: 34,473,633 C302R possibly damaging Het
Fbxl5 G A 5: 43,758,745 Q442* probably null Het
Fhdc1 A G 3: 84,451,483 S370P probably damaging Het
Gm35911 A G 5: 99,924,926 I111V probably benign Het
Gtf3c6 T C 10: 40,257,473 probably null Het
I830077J02Rik A G 3: 105,927,998 V21A probably benign Het
Inf2 G T 12: 112,601,640 E209* probably null Het
Irs1 A T 1: 82,289,739 M252K probably damaging Het
Kcng3 C A 17: 83,631,087 V178L probably damaging Het
Kif16b A C 2: 142,901,365 S3A probably benign Het
Kit T C 5: 75,652,805 M884T probably damaging Het
Kmt2a A T 9: 44,819,290 probably benign Het
Kptn T C 7: 16,123,976 I243T probably benign Het
Loxhd1 G A 18: 77,380,496 E947K possibly damaging Het
Lyl1 A T 8: 84,702,847 I62L probably damaging Het
Mrvi1 A G 7: 110,899,672 probably null Het
Mtx2 G A 2: 74,876,370 D230N probably benign Het
Ndufa5 A T 6: 24,522,758 Y28* probably null Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Nrxn3 A G 12: 90,204,664 N923S probably benign Het
Ogfod2 C T 5: 124,113,475 T116M possibly damaging Het
Olfr1220 A G 2: 89,097,843 V28A probably benign Het
Olfr492 T A 7: 108,322,906 T257S probably benign Het
Olfr835 A T 9: 19,035,575 I151F probably benign Het
Olfr846 A C 9: 19,361,208 V49G probably damaging Het
Oosp1 T C 19: 11,667,754 E182G possibly damaging Het
Oxnad1 C A 14: 32,092,091 T47K possibly damaging Het
Pcdha5 A G 18: 36,962,738 M767V possibly damaging Het
Pcnx3 A T 19: 5,665,745 H1444Q probably benign Het
Pde4dip G T 3: 97,696,993 Q2224K probably benign Het
Pgr A T 9: 8,956,340 H763L possibly damaging Het
Plec T C 15: 76,174,310 D3809G probably damaging Het
Ppfia1 A G 7: 144,520,693 S155P probably damaging Het
Ppfia4 A G 1: 134,300,528 V1090A probably benign Het
Ptgdr T C 14: 44,858,685 E190G probably benign Het
Rhbdd2 T A 5: 135,636,335 C173* probably null Het
Rhobtb1 C A 10: 69,266,290 P134T probably damaging Het
Slc25a36 A T 9: 97,080,452 F161L probably benign Het
Slc5a11 A G 7: 123,269,976 T596A probably benign Het
Slco1a6 T C 6: 142,089,900 Y566C probably damaging Het
Snx15 T G 19: 6,119,915 K321T probably damaging Het
Snx15 T C 19: 6,119,916 K321E probably damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Syt8 T C 7: 142,438,268 I32T probably benign Het
Thumpd1 T C 7: 119,720,585 N53D possibly damaging Het
Timm21 T C 18: 84,951,138 T54A probably benign Het
Tmed10 A G 12: 85,344,317 V149A probably damaging Het
Tmem108 T A 9: 103,499,885 M122L probably benign Het
Tram1l1 A G 3: 124,321,787 I199V probably benign Het
Tspan8 A G 10: 115,839,897 N156S probably benign Het
Vars T C 17: 35,011,504 V521A probably benign Het
Vmn2r54 G T 7: 12,615,816 T613N possibly damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Vps33a T C 5: 123,533,952 K451R probably benign Het
Vsig10l T C 7: 43,463,729 I35T probably benign Het
Xpnpep3 T A 15: 81,448,459 L399Q probably damaging Het
Zfp438 T C 18: 5,214,013 E315G probably benign Het
Zfp467 C T 6: 48,439,334 G128D probably damaging Het
Other mutations in Mmp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Mmp24 APN 2 155799887 missense probably damaging 1.00
IGL02089:Mmp24 APN 2 155812293 missense probably damaging 1.00
IGL02452:Mmp24 APN 2 155815788 missense probably damaging 1.00
R0600:Mmp24 UTSW 2 155792597 missense probably benign 0.01
R1381:Mmp24 UTSW 2 155814127 missense possibly damaging 0.46
R4497:Mmp24 UTSW 2 155813988 missense possibly damaging 0.85
R4498:Mmp24 UTSW 2 155813988 missense possibly damaging 0.85
R4727:Mmp24 UTSW 2 155815899 missense possibly damaging 0.55
R4985:Mmp24 UTSW 2 155814096 missense probably damaging 0.99
R5020:Mmp24 UTSW 2 155810284 missense probably benign 0.09
R5501:Mmp24 UTSW 2 155798136 missense probably damaging 1.00
R5686:Mmp24 UTSW 2 155799777 missense probably damaging 0.99
R5709:Mmp24 UTSW 2 155792542 missense probably damaging 1.00
R5773:Mmp24 UTSW 2 155799909 missense probably damaging 1.00
R6452:Mmp24 UTSW 2 155815753 missense possibly damaging 0.67
R6657:Mmp24 UTSW 2 155798179 missense probably damaging 1.00
R7015:Mmp24 UTSW 2 155792624 missense probably damaging 0.99
R7699:Mmp24 UTSW 2 155798176 missense probably damaging 0.99
R8076:Mmp24 UTSW 2 155807561 nonsense probably null
R8111:Mmp24 UTSW 2 155807425 missense possibly damaging 0.81
R8304:Mmp24 UTSW 2 155799839 missense possibly damaging 0.85
R8344:Mmp24 UTSW 2 155810303 missense possibly damaging 0.68
Z1176:Mmp24 UTSW 2 155810392 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACATTCCGGCTTCATGAATG -3'
(R):5'- GGCCCTTGAGAACCACATAAG -3'

Sequencing Primer
(F):5'- CTCACGGAGGCTGATTCTG -3'
(R):5'- GCCCTTGAGAACCACATAAGATTAAC -3'
Posted On2020-06-30