Mutagenetix > Incidental Mutation

Incidental Mutation 'R8139:Pde4dip'

632394

Institutional Source

Beutler Lab

Gene Symbol

Pde4dip

Ensembl Gene

ENSMUSG00000038170

Gene Name

phosphodiesterase 4D interacting protein (myomegalin)

Synonyms

D130016K21Rik, Usmg4, 4732458A06Rik, D3Bwg1078e, 9430063L05Rik

MMRRC Submission

Accession Numbers

Genbank:NM_001039376.2, NM_001110163.1, NM_178080.4, NM_177145.3; MGI: 1891434; Ensembl: ENSMUST00000045243, ENSMUST00000090750, ENSMUST00000107038, ENSMUST00000163531, ENSMUST00000168438

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8139 (G1)

Quality Score

201.009

Status

Validated

Chromosome

Chromosomal Location

97689824-97888707 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 97696993 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 2224 (Q2224K)

Ref Sequence

ENSEMBL: ENSMUSP00000088254 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090750] [ENSMUST00000168438]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000090750
AA Change: Q2224K

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000088254
Gene: ENSMUSG00000038170
AA Change: Q2224K

Domain	Start	End	E-Value	Type
low complexity region	10	40	N/A	INTRINSIC
low complexity region	45	57	N/A	INTRINSIC
Pfam:Cnn_1N	124	196	3.2e-26	PFAM
low complexity region	204	219	N/A	INTRINSIC
coiled coil region	282	325	N/A	INTRINSIC
internal_repeat_1	397	438	4.03e-5	PROSPERO
low complexity region	567	578	N/A	INTRINSIC
internal_repeat_2	617	667	6.59e-5	PROSPERO
internal_repeat_1	620	661	4.03e-5	PROSPERO
coiled coil region	866	942	N/A	INTRINSIC
low complexity region	1038	1056	N/A	INTRINSIC
low complexity region	1067	1082	N/A	INTRINSIC
coiled coil region	1118	1163	N/A	INTRINSIC
coiled coil region	1336	1363	N/A	INTRINSIC
low complexity region	1403	1420	N/A	INTRINSIC
coiled coil region	1470	1508	N/A	INTRINSIC
internal_repeat_2	1597	1644	6.59e-5	PROSPERO
DUF1220	1680	1747	1.17e-17	SMART
low complexity region	1758	1780	N/A	INTRINSIC
low complexity region	1836	1851	N/A	INTRINSIC
low complexity region	1860	1874	N/A	INTRINSIC
low complexity region	1940	1951	N/A	INTRINSIC
coiled coil region	1962	2138	N/A	INTRINSIC
coiled coil region	2162	2197	N/A	INTRINSIC
coiled coil region	2387	2431	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168438
AA Change: Q2173K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000131170
Gene: ENSMUSG00000038170
AA Change: Q2173K

Domain	Start	End	E-Value	Type
low complexity region	10	40	N/A	INTRINSIC
low complexity region	45	57	N/A	INTRINSIC
Pfam:Microtub_assoc	124	198	1.4e-31	PFAM
low complexity region	204	219	N/A	INTRINSIC
coiled coil region	282	325	N/A	INTRINSIC
internal_repeat_1	397	438	3.56e-5	PROSPERO
low complexity region	567	578	N/A	INTRINSIC
internal_repeat_2	617	667	5.83e-5	PROSPERO
internal_repeat_1	620	661	3.56e-5	PROSPERO
coiled coil region	866	942	N/A	INTRINSIC
low complexity region	1038	1056	N/A	INTRINSIC
low complexity region	1067	1082	N/A	INTRINSIC
coiled coil region	1118	1163	N/A	INTRINSIC
coiled coil region	1336	1363	N/A	INTRINSIC
low complexity region	1403	1420	N/A	INTRINSIC
coiled coil region	1470	1508	N/A	INTRINSIC
internal_repeat_2	1597	1644	5.83e-5	PROSPERO
DUF1220	1680	1747	1.17e-17	SMART
low complexity region	1758	1769	N/A	INTRINSIC
low complexity region	1785	1800	N/A	INTRINSIC
low complexity region	1809	1823	N/A	INTRINSIC
low complexity region	1889	1900	N/A	INTRINSIC
coiled coil region	1911	2087	N/A	INTRINSIC
coiled coil region	2111	2146	N/A	INTRINSIC
coiled coil region	2336	2380	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 94.2%

Validation Efficiency

100% (84/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit partial (in utero or perinatal) lethality, hyperactivity, and increased vertical activity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	G	T	X: 70,394,514	Q58K	possibly damaging	Het
9130409I23Rik	A	G	1: 181,054,793	D40G	probably damaging	Het
Aamdc	T	C	7: 97,565,243	M42V	probably benign	Het
Abca6	T	A	11: 110,184,133	Q1368L	probably damaging	Het
Best3	G	A	10: 117,004,426	G254R	probably damaging	Het
Cacna1h	A	T	17: 25,383,723	I1478N	probably damaging	Het
Ccdc113	T	A	8: 95,558,738	M350K	possibly damaging	Het
Cdc42bpa	A	T	1: 180,069,319	H389L	probably damaging	Het
Cnn3	G	T	3: 121,455,069	M208I	probably damaging	Het
Col11a1	A	G	3: 114,097,049	D345G	unknown	Het
Dnah14	G	T	1: 181,755,288	V3131F	probably damaging	Het
Dst	T	A	1: 34,191,852	M2842K	probably benign	Het
Dus3l	C	T	17: 56,767,058	Q211*	probably null	Het
Eftud2	A	G	11: 102,867,859	F171S	probably benign	Het
Elac2	T	C	11: 64,980,614	I117T	probably benign	Het
Fam13b	A	G	18: 34,473,633	C302R	possibly damaging	Het
Fbxl5	G	A	5: 43,758,745	Q442*	probably null	Het
Fhdc1	A	G	3: 84,451,483	S370P	probably damaging	Het
Gm35911	A	G	5: 99,924,926	I111V	probably benign	Het
Gtf3c6	T	C	10: 40,257,473		probably null	Het
I830077J02Rik	A	G	3: 105,927,998	V21A	probably benign	Het
Inf2	G	T	12: 112,601,640	E209*	probably null	Het
Irs1	A	T	1: 82,289,739	M252K	probably damaging	Het
Kcng3	C	A	17: 83,631,087	V178L	probably damaging	Het
Kif16b	A	C	2: 142,901,365	S3A	probably benign	Het
Kit	T	C	5: 75,652,805	M884T	probably damaging	Het
Kmt2a	A	T	9: 44,819,290		probably benign	Het
Kptn	T	C	7: 16,123,976	I243T	probably benign	Het
Loxhd1	G	A	18: 77,380,496	E947K	possibly damaging	Het
Lyl1	A	T	8: 84,702,847	I62L	probably damaging	Het
Mmp24	C	T	2: 155,814,045	R468*	probably null	Het
Mrvi1	A	G	7: 110,899,672		probably null	Het
Mtx2	G	A	2: 74,876,370	D230N	probably benign	Het
Ndufa5	A	T	6: 24,522,758	Y28*	probably null	Het
Notch4	G	T	17: 34,584,800	E1515*	probably null	Het
Nrxn3	A	G	12: 90,204,664	N923S	probably benign	Het
Ogfod2	C	T	5: 124,113,475	T116M	possibly damaging	Het
Olfr1220	A	G	2: 89,097,843	V28A	probably benign	Het
Olfr492	T	A	7: 108,322,906	T257S	probably benign	Het
Olfr835	A	T	9: 19,035,575	I151F	probably benign	Het
Olfr846	A	C	9: 19,361,208	V49G	probably damaging	Het
Oosp1	T	C	19: 11,667,754	E182G	possibly damaging	Het
Oxnad1	C	A	14: 32,092,091	T47K	possibly damaging	Het
Pcdha5	A	G	18: 36,962,738	M767V	possibly damaging	Het
Pcnx3	A	T	19: 5,665,745	H1444Q	probably benign	Het
Pgr	A	T	9: 8,956,340	H763L	possibly damaging	Het
Plec	T	C	15: 76,174,310	D3809G	probably damaging	Het
Ppfia1	A	G	7: 144,520,693	S155P	probably damaging	Het
Ppfia4	A	G	1: 134,300,528	V1090A	probably benign	Het
Ptgdr	T	C	14: 44,858,685	E190G	probably benign	Het
Rhbdd2	T	A	5: 135,636,335	C173*	probably null	Het
Rhobtb1	C	A	10: 69,266,290	P134T	probably damaging	Het
Slc25a36	A	T	9: 97,080,452	F161L	probably benign	Het
Slc5a11	A	G	7: 123,269,976	T596A	probably benign	Het
Slco1a6	T	C	6: 142,089,900	Y566C	probably damaging	Het
Snx15	T	G	19: 6,119,915	K321T	probably damaging	Het
Snx15	T	C	19: 6,119,916	K321E	probably damaging	Het
Srebf2	C	T	15: 82,178,765	R468C	probably damaging	Het
Syt8	T	C	7: 142,438,268	I32T	probably benign	Het
Thumpd1	T	C	7: 119,720,585	N53D	possibly damaging	Het
Timm21	T	C	18: 84,951,138	T54A	probably benign	Het
Tmed10	A	G	12: 85,344,317	V149A	probably damaging	Het
Tmem108	T	A	9: 103,499,885	M122L	probably benign	Het
Tram1l1	A	G	3: 124,321,787	I199V	probably benign	Het
Tspan8	A	G	10: 115,839,897	N156S	probably benign	Het
Vars	T	C	17: 35,011,504	V521A	probably benign	Het
Vmn2r54	G	T	7: 12,615,816	T613N	possibly damaging	Het
Vps13b	T	A	15: 35,607,272	L1117*	probably null	Het
Vps33a	T	C	5: 123,533,952	K451R	probably benign	Het
Vsig10l	T	C	7: 43,463,729	I35T	probably benign	Het
Xpnpep3	T	A	15: 81,448,459	L399Q	probably damaging	Het
Zfp438	T	C	18: 5,214,013	E315G	probably benign	Het
Zfp467	C	T	6: 48,439,334	G128D	probably damaging	Het

Other mutations in Pde4dip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Pde4dip	APN	3	97767277	missense	probably benign	0.00
IGL00543:Pde4dip	APN	3	97757624	missense	possibly damaging	0.91
IGL00979:Pde4dip	APN	3	97747758	splice site	probably benign
IGL01483:Pde4dip	APN	3	97754149	missense	probably damaging	1.00
IGL02122:Pde4dip	APN	3	97767421	missense	probably damaging	1.00
IGL02398:Pde4dip	APN	3	97766781	missense	probably benign
IGL02814:Pde4dip	APN	3	97767100	missense	probably damaging	1.00
IGL02826:Pde4dip	APN	3	97767087	missense	probably damaging	1.00
D3080:Pde4dip	UTSW	3	97766830	missense	probably damaging	1.00
R0077:Pde4dip	UTSW	3	97753126	nonsense	probably null
R0096:Pde4dip	UTSW	3	97767467	missense	probably damaging	0.99
R0277:Pde4dip	UTSW	3	97843712	missense	probably benign	0.01
R0304:Pde4dip	UTSW	3	97843712	missense	probably benign	0.01
R0616:Pde4dip	UTSW	3	97747533	missense	probably benign	0.09
R0676:Pde4dip	UTSW	3	97717097	splice site	probably benign
R1166:Pde4dip	UTSW	3	97713196	missense	possibly damaging	0.94
R1376:Pde4dip	UTSW	3	97743217	missense	probably damaging	0.99
R1376:Pde4dip	UTSW	3	97743217	missense	probably damaging	0.99
R1452:Pde4dip	UTSW	3	97724102	missense	probably damaging	1.00
R1550:Pde4dip	UTSW	3	97719704	missense	probably damaging	1.00
R1700:Pde4dip	UTSW	3	97703323	missense	probably benign	0.00
R1704:Pde4dip	UTSW	3	97754260	missense	probably benign	0.28
R1769:Pde4dip	UTSW	3	97695930	missense	probably benign	0.00
R1934:Pde4dip	UTSW	3	97692691	missense	possibly damaging	0.74
R1980:Pde4dip	UTSW	3	97756996	missense	possibly damaging	0.93
R2088:Pde4dip	UTSW	3	97754433	missense	probably null	1.00
R2143:Pde4dip	UTSW	3	97888519	missense	possibly damaging	0.86
R2149:Pde4dip	UTSW	3	97792836	missense	possibly damaging	0.64
R2156:Pde4dip	UTSW	3	97724218	missense	probably damaging	0.98
R2158:Pde4dip	UTSW	3	97757621	missense	probably benign	0.15
R2240:Pde4dip	UTSW	3	97724164	missense	probably benign	0.00
R2249:Pde4dip	UTSW	3	97793525	missense	probably damaging	1.00
R2256:Pde4dip	UTSW	3	97718184	missense	probably damaging	1.00
R2680:Pde4dip	UTSW	3	97701617	missense	possibly damaging	0.92
R2921:Pde4dip	UTSW	3	97719569	missense	probably benign
R3407:Pde4dip	UTSW	3	97754468	missense	probably damaging	1.00
R3736:Pde4dip	UTSW	3	97724111	missense	probably damaging	1.00
R3787:Pde4dip	UTSW	3	97715552	missense	possibly damaging	0.80
R3883:Pde4dip	UTSW	3	97713188	missense	probably damaging	1.00
R4437:Pde4dip	UTSW	3	97766569	missense	possibly damaging	0.52
R4528:Pde4dip	UTSW	3	97717022	missense	probably damaging	1.00
R4576:Pde4dip	UTSW	3	97754249	missense	probably damaging	1.00
R4600:Pde4dip	UTSW	3	97695944	missense	probably damaging	0.98
R4653:Pde4dip	UTSW	3	97767338	missense	probably damaging	0.99
R4678:Pde4dip	UTSW	3	97695005	missense	probably damaging	1.00
R4679:Pde4dip	UTSW	3	97695005	missense	probably damaging	1.00
R4688:Pde4dip	UTSW	3	97843677	nonsense	probably null
R4770:Pde4dip	UTSW	3	97767084	missense	probably damaging	1.00
R4841:Pde4dip	UTSW	3	97793528	missense	probably damaging	1.00
R4842:Pde4dip	UTSW	3	97793528	missense	probably damaging	1.00
R4899:Pde4dip	UTSW	3	97709558	missense	probably damaging	1.00
R4914:Pde4dip	UTSW	3	97715328	missense	probably benign	0.10
R4943:Pde4dip	UTSW	3	97755511	missense	probably damaging	0.99
R5131:Pde4dip	UTSW	3	97709514	missense	probably damaging	0.98
R5408:Pde4dip	UTSW	3	97796736	missense	probably benign	0.35
R5583:Pde4dip	UTSW	3	97747576	missense	possibly damaging	0.67
R5677:Pde4dip	UTSW	3	97841648	nonsense	probably null
R5689:Pde4dip	UTSW	3	97692367	nonsense	probably null
R5696:Pde4dip	UTSW	3	97709490	missense	probably damaging	1.00
R5860:Pde4dip	UTSW	3	97724188	missense	possibly damaging	0.68
R6279:Pde4dip	UTSW	3	97699180	missense	probably damaging	1.00
R6341:Pde4dip	UTSW	3	97694911	missense	probably benign
R6440:Pde4dip	UTSW	3	97767586	missense	probably damaging	1.00
R6464:Pde4dip	UTSW	3	97710344	missense	probably damaging	1.00
R6489:Pde4dip	UTSW	3	97755591	nonsense	probably null
R6706:Pde4dip	UTSW	3	97741393	missense	probably damaging	1.00
R6722:Pde4dip	UTSW	3	97718239	nonsense	probably null
R6798:Pde4dip	UTSW	3	97888534	missense	probably benign
R6804:Pde4dip	UTSW	3	97793248	nonsense	probably null
R6862:Pde4dip	UTSW	3	97767024	missense	possibly damaging	0.52
R6957:Pde4dip	UTSW	3	97824333	splice site	probably null
R6983:Pde4dip	UTSW	3	97718236	missense	probably damaging	1.00
R7014:Pde4dip	UTSW	3	97715422	missense	possibly damaging	0.54
R7025:Pde4dip	UTSW	3	97724183	nonsense	probably null
R7136:Pde4dip	UTSW	3	97694063	missense	probably benign	0.03
R7178:Pde4dip	UTSW	3	97715630	missense	probably benign	0.26
R7269:Pde4dip	UTSW	3	97766959	missense	probably damaging	1.00
R7283:Pde4dip	UTSW	3	97758882	missense	probably benign	0.03
R7354:Pde4dip	UTSW	3	97719330	missense	probably damaging	0.99
R7357:Pde4dip	UTSW	3	97715541	missense	probably benign	0.01
R7360:Pde4dip	UTSW	3	97718316	missense	probably benign	0.01
R7371:Pde4dip	UTSW	3	97757271	missense	probably benign	0.08
R7432:Pde4dip	UTSW	3	97695092	missense	probably benign
R7536:Pde4dip	UTSW	3	97757244	missense	probably damaging	1.00
R7542:Pde4dip	UTSW	3	97766655	missense	possibly damaging	0.59
R7609:Pde4dip	UTSW	3	97715565	missense	possibly damaging	0.85
R7650:Pde4dip	UTSW	3	97699107	critical splice donor site	probably null
R7800:Pde4dip	UTSW	3	97715283	missense	probably damaging	1.00
R7846:Pde4dip	UTSW	3	97715174	missense	probably damaging	1.00
R7918:Pde4dip	UTSW	3	97715223	nonsense	probably null
R8120:Pde4dip	UTSW	3	97706938	missense	probably null	0.94
R8144:Pde4dip	UTSW	3	97715426	missense	probably damaging	1.00
R8177:Pde4dip	UTSW	3	97767532	missense	probably damaging	0.98
R8294:Pde4dip	UTSW	3	97767378	missense	probably damaging	1.00
R8406:Pde4dip	UTSW	3	97699112	missense	probably benign	0.04
R8911:Pde4dip	UTSW	3	97743601	missense	probably benign	0.22
R8912:Pde4dip	UTSW	3	97710317	missense	probably damaging	1.00
R8960:Pde4dip	UTSW	3	97793148	missense	probably damaging	1.00
R8993:Pde4dip	UTSW	3	97766494	missense	probably damaging	1.00
R9031:Pde4dip	UTSW	3	97692359	missense	probably damaging	1.00
R9032:Pde4dip	UTSW	3	97694069	missense	probably benign	0.00
R9085:Pde4dip	UTSW	3	97694069	missense	probably benign	0.00
R9103:Pde4dip	UTSW	3	97841728	missense	probably damaging	1.00
R9163:Pde4dip	UTSW	3	97751807	critical splice donor site	probably null
R9182:Pde4dip	UTSW	3	97694998	missense	probably benign	0.13
R9185:Pde4dip	UTSW	3	97758816	missense	probably benign	0.01
R9286:Pde4dip	UTSW	3	97699867	missense	probably damaging	1.00
R9357:Pde4dip	UTSW	3	97718329	missense	probably benign	0.00
R9415:Pde4dip	UTSW	3	97753152	missense	possibly damaging	0.82
R9500:Pde4dip	UTSW	3	97888580	missense	unknown
R9595:Pde4dip	UTSW	3	97694891	critical splice donor site	probably null
R9689:Pde4dip	UTSW	3	97742525	missense	probably damaging	1.00
R9720:Pde4dip	UTSW	3	97695971	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCAAGTCCAGGGATGCTG -3'
(R):5'- AAGTCCCGGGTGAGTTAAGC -3'

Sequencing Primer
(F):5'- CTTGTGAGAAGCAAACTCAGAATCTG -3'
(R):5'- CGGGTGAGTTAAGCTGCCTG -3'

Posted On

2020-06-30