Incidental Mutation 'R8139:Cnn3'
ID632397
Institutional Source Beutler Lab
Gene Symbol Cnn3
Ensembl Gene ENSMUSG00000053931
Gene Namecalponin 3, acidic
SynonymsCalpo3, 1600014M03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R8139 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location121426497-121458207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 121455069 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 208 (M208I)
Ref Sequence ENSEMBL: ENSMUSP00000029773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029773] [ENSMUST00000039197] [ENSMUST00000197135] [ENSMUST00000198393]
Predicted Effect probably damaging
Transcript: ENSMUST00000029773
AA Change: M208I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029773
Gene: ENSMUSG00000053931
AA Change: M208I

DomainStartEndE-ValueType
CH 28 125 3.92e-27 SMART
Pfam:Calponin 164 188 1.1e-19 PFAM
Pfam:Calponin 204 228 7.4e-17 PFAM
Pfam:Calponin 243 267 1.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000039197
SMART Domains Protein: ENSMUSP00000040210
Gene: ENSMUSG00000039865

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 217 239 N/A INTRINSIC
transmembrane domain 244 266 N/A INTRINSIC
Pfam:Choline_transpo 291 607 2.3e-80 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197135
AA Change: M162I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142526
Gene: ENSMUSG00000053931
AA Change: M162I

DomainStartEndE-ValueType
CH 28 120 8.6e-10 SMART
Pfam:Calponin 158 183 1e-10 PFAM
Pfam:Calponin 197 222 9.6e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198393
AA Change: M111I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143186
Gene: ENSMUSG00000053931
AA Change: M111I

DomainStartEndE-ValueType
Blast:CH 1 28 7e-12 BLAST
SCOP:d1h67a_ 1 35 9e-9 SMART
PDB:1WYN|A 1 53 3e-21 PDB
Pfam:Calponin 67 92 1.2e-14 PFAM
Pfam:Calponin 107 132 3.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198620
Predicted Effect probably benign
Transcript: ENSMUST00000199499
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a markedly acidic C terminus; the basic N-terminus is highly homologous to the N-terminus of a related gene, CNN1. Members of the CNN gene family all contain similar tandemly repeated motifs. This encoded protein is associated with the cytoskeleton but is not involved in contraction. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe exencephaly, neuronal tissue overgrowth and die immediately postnatal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G T X: 70,394,514 Q58K possibly damaging Het
9130409I23Rik A G 1: 181,054,793 D40G probably damaging Het
Aamdc T C 7: 97,565,243 M42V probably benign Het
Abca6 T A 11: 110,184,133 Q1368L probably damaging Het
Best3 G A 10: 117,004,426 G254R probably damaging Het
Cacna1h A T 17: 25,383,723 I1478N probably damaging Het
Ccdc113 T A 8: 95,558,738 M350K possibly damaging Het
Cdc42bpa A T 1: 180,069,319 H389L probably damaging Het
Col11a1 A G 3: 114,097,049 D345G unknown Het
Dnah14 G T 1: 181,755,288 V3131F probably damaging Het
Dst T A 1: 34,191,852 M2842K probably benign Het
Dus3l C T 17: 56,767,058 Q211* probably null Het
Eftud2 A G 11: 102,867,859 F171S probably benign Het
Elac2 T C 11: 64,980,614 I117T probably benign Het
Fam13b A G 18: 34,473,633 C302R possibly damaging Het
Fbxl5 G A 5: 43,758,745 Q442* probably null Het
Fhdc1 A G 3: 84,451,483 S370P probably damaging Het
Gm35911 A G 5: 99,924,926 I111V probably benign Het
Gtf3c6 T C 10: 40,257,473 probably null Het
I830077J02Rik A G 3: 105,927,998 V21A probably benign Het
Inf2 G T 12: 112,601,640 E209* probably null Het
Irs1 A T 1: 82,289,739 M252K probably damaging Het
Kcng3 C A 17: 83,631,087 V178L probably damaging Het
Kif16b A C 2: 142,901,365 S3A probably benign Het
Kit T C 5: 75,652,805 M884T probably damaging Het
Kmt2a A T 9: 44,819,290 probably benign Het
Kptn T C 7: 16,123,976 I243T probably benign Het
Loxhd1 G A 18: 77,380,496 E947K possibly damaging Het
Lyl1 A T 8: 84,702,847 I62L probably damaging Het
Mmp24 C T 2: 155,814,045 R468* probably null Het
Mrvi1 A G 7: 110,899,672 probably null Het
Mtx2 G A 2: 74,876,370 D230N probably benign Het
Ndufa5 A T 6: 24,522,758 Y28* probably null Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Nrxn3 A G 12: 90,204,664 N923S probably benign Het
Ogfod2 C T 5: 124,113,475 T116M possibly damaging Het
Olfr1220 A G 2: 89,097,843 V28A probably benign Het
Olfr492 T A 7: 108,322,906 T257S probably benign Het
Olfr835 A T 9: 19,035,575 I151F probably benign Het
Olfr846 A C 9: 19,361,208 V49G probably damaging Het
Oosp1 T C 19: 11,667,754 E182G possibly damaging Het
Oxnad1 C A 14: 32,092,091 T47K possibly damaging Het
Pcdha5 A G 18: 36,962,738 M767V possibly damaging Het
Pcnx3 A T 19: 5,665,745 H1444Q probably benign Het
Pde4dip G T 3: 97,696,993 Q2224K probably benign Het
Pgr A T 9: 8,956,340 H763L possibly damaging Het
Plec T C 15: 76,174,310 D3809G probably damaging Het
Ppfia1 A G 7: 144,520,693 S155P probably damaging Het
Ppfia4 A G 1: 134,300,528 V1090A probably benign Het
Ptgdr T C 14: 44,858,685 E190G probably benign Het
Rhbdd2 T A 5: 135,636,335 C173* probably null Het
Rhobtb1 C A 10: 69,266,290 P134T probably damaging Het
Slc25a36 A T 9: 97,080,452 F161L probably benign Het
Slc5a11 A G 7: 123,269,976 T596A probably benign Het
Slco1a6 T C 6: 142,089,900 Y566C probably damaging Het
Snx15 T G 19: 6,119,915 K321T probably damaging Het
Snx15 T C 19: 6,119,916 K321E probably damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Syt8 T C 7: 142,438,268 I32T probably benign Het
Thumpd1 T C 7: 119,720,585 N53D possibly damaging Het
Timm21 T C 18: 84,951,138 T54A probably benign Het
Tmed10 A G 12: 85,344,317 V149A probably damaging Het
Tmem108 T A 9: 103,499,885 M122L probably benign Het
Tram1l1 A G 3: 124,321,787 I199V probably benign Het
Tspan8 A G 10: 115,839,897 N156S probably benign Het
Vars T C 17: 35,011,504 V521A probably benign Het
Vmn2r54 G T 7: 12,615,816 T613N possibly damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Vps33a T C 5: 123,533,952 K451R probably benign Het
Vsig10l T C 7: 43,463,729 I35T probably benign Het
Xpnpep3 T A 15: 81,448,459 L399Q probably damaging Het
Zfp438 T C 18: 5,214,013 E315G probably benign Het
Zfp467 C T 6: 48,439,334 G128D probably damaging Het
Other mutations in Cnn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02900:Cnn3 APN 3 121451494 missense probably benign 0.03
BB009:Cnn3 UTSW 3 121451429 missense probably benign 0.15
BB019:Cnn3 UTSW 3 121451429 missense probably benign 0.15
R0711:Cnn3 UTSW 3 121449984 missense probably benign 0.00
R0811:Cnn3 UTSW 3 121454951 missense probably damaging 1.00
R0812:Cnn3 UTSW 3 121454951 missense probably damaging 1.00
R1368:Cnn3 UTSW 3 121457137 missense probably benign 0.01
R1567:Cnn3 UTSW 3 121449958 nonsense probably null
R1675:Cnn3 UTSW 3 121457169 nonsense probably null
R2132:Cnn3 UTSW 3 121451935 missense probably damaging 0.97
R2851:Cnn3 UTSW 3 121450053 start gained probably benign
R5850:Cnn3 UTSW 3 121451928 missense probably damaging 0.99
R6936:Cnn3 UTSW 3 121450053 start gained probably benign
R7196:Cnn3 UTSW 3 121454788 splice site probably null
R7851:Cnn3 UTSW 3 121457343 missense possibly damaging 0.85
R7866:Cnn3 UTSW 3 121451393 missense probably benign 0.16
R7867:Cnn3 UTSW 3 121455055 missense probably benign 0.27
R7932:Cnn3 UTSW 3 121451429 missense probably benign 0.15
R8320:Cnn3 UTSW 3 121449986 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAACGTAGGCTTGTGCG -3'
(R):5'- TTTTAGGCTGCAGAAAGGGC -3'

Sequencing Primer
(F):5'- GTATGCTGCTGTTGACTTCTGATAAC -3'
(R):5'- TGCAGAAAGGGCCCTTTG -3'
Posted On2020-06-30