Incidental Mutation 'R8139:Fbxl5'
ID632399
Institutional Source Beutler Lab
Gene Symbol Fbxl5
Ensembl Gene ENSMUSG00000039753
Gene NameF-box and leucine-rich repeat protein 5
SynonymsFbl4, Fir4
MMRRC Submission
Accession Numbers

Genbank: NM_001159963.1, NM_178729.4; Ensemble: ENSMUST00000114047, ENSMUST00000114047, ENSMUST00000119523, ENSMUST00000141902, ENSMUST00000087465, ENSMUST00000121736, ENSMUST00000124610                                     

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8139 (G1)
Quality Score211.009
Status Validated
Chromosome5
Chromosomal Location43744615-43821638 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 43758745 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 442 (Q442*)
Ref Sequence ENSEMBL: ENSMUSP00000045792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047857] [ENSMUST00000087465] [ENSMUST00000114047] [ENSMUST00000119523] [ENSMUST00000121736] [ENSMUST00000124610] [ENSMUST00000196483]
Predicted Effect probably null
Transcript: ENSMUST00000047857
AA Change: Q442*
SMART Domains Protein: ENSMUSP00000045792
Gene: ENSMUSG00000039753
AA Change: Q442*

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 138 1.3e-10 PFAM
FBOX 208 248 2.31e-9 SMART
low complexity region 289 310 N/A INTRINSIC
LRR 355 379 2.43e2 SMART
LRR 382 407 4.87e-4 SMART
low complexity region 481 492 N/A INTRINSIC
LRR 596 621 2.45e0 SMART
LRR 624 649 4.65e-1 SMART
Blast:LRR 650 681 2e-13 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000087465
AA Change: Q442*
SMART Domains Protein: ENSMUSP00000084733
Gene: ENSMUSG00000039753
AA Change: Q442*

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 138 4.3e-15 PFAM
FBOX 208 248 2.31e-9 SMART
low complexity region 289 310 N/A INTRINSIC
LRR 355 379 2.43e2 SMART
LRR 382 407 4.87e-4 SMART
low complexity region 481 492 N/A INTRINSIC
LRR 596 621 1.23e2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114047
AA Change: Q436*
SMART Domains Protein: ENSMUSP00000109681
Gene: ENSMUSG00000039753
AA Change: Q436*

DomainStartEndE-ValueType
Pfam:Hemerythrin 19 132 4.4e-11 PFAM
FBOX 202 242 2.31e-9 SMART
low complexity region 283 304 N/A INTRINSIC
LRR 349 373 2.43e2 SMART
LRR 376 401 4.87e-4 SMART
low complexity region 475 486 N/A INTRINSIC
LRR 590 615 2.45e0 SMART
LRR 618 643 4.65e-1 SMART
Blast:LRR 644 675 2e-13 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000119523
AA Change: Q425*
SMART Domains Protein: ENSMUSP00000113557
Gene: ENSMUSG00000039753
AA Change: Q425*

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 121 2.2e-9 PFAM
FBOX 191 231 2.31e-9 SMART
low complexity region 272 293 N/A INTRINSIC
LRR 338 362 2.43e2 SMART
LRR 365 390 4.87e-4 SMART
low complexity region 464 475 N/A INTRINSIC
LRR 579 604 2.45e0 SMART
LRR 607 632 4.65e-1 SMART
Blast:LRR 633 664 2e-13 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000121736
AA Change: Q399*
SMART Domains Protein: ENSMUSP00000112444
Gene: ENSMUSG00000039753
AA Change: Q399*

DomainStartEndE-ValueType
PDB:3V5Z|B 1 118 2e-71 PDB
FBOX 165 205 2.31e-9 SMART
low complexity region 246 267 N/A INTRINSIC
LRR 312 336 2.43e2 SMART
LRR 339 364 4.87e-4 SMART
low complexity region 438 449 N/A INTRINSIC
LRR 553 578 1.23e2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000124610
AA Change: Q442*
SMART Domains Protein: ENSMUSP00000116720
Gene: ENSMUSG00000039753
AA Change: Q442*

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 138 5.7e-12 PFAM
FBOX 208 248 1.5e-11 SMART
low complexity region 289 310 N/A INTRINSIC
LRR 355 379 1e0 SMART
LRR 382 407 2e-6 SMART
low complexity region 481 492 N/A INTRINSIC
LRR 596 621 1e-2 SMART
LRR 624 649 1.9e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000141902
AA Change: Q362*
SMART Domains Protein: ENSMUSP00000120338
Gene: ENSMUSG00000039753
AA Change: Q362*

DomainStartEndE-ValueType
PDB:3V5Z|B 2 82 3e-43 PDB
FBOX 129 169 2.31e-9 SMART
low complexity region 210 231 N/A INTRINSIC
LRR 276 300 2.43e2 SMART
LRR 303 328 4.87e-4 SMART
low complexity region 402 413 N/A INTRINSIC
LRR 517 542 2.45e0 SMART
LRR 545 570 4.65e-1 SMART
Blast:LRR 571 602 3e-13 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000196483
AA Change: Q441*
SMART Domains Protein: ENSMUSP00000143703
Gene: ENSMUSG00000039753
AA Change: Q441*

DomainStartEndE-ValueType
Pfam:Hemerythrin 6 138 1.3e-10 PFAM
FBOX 208 248 2.31e-9 SMART
low complexity region 289 309 N/A INTRINSIC
LRR 354 378 2.43e2 SMART
LRR 381 406 4.87e-4 SMART
low complexity region 480 491 N/A INTRINSIC
LRR 595 620 2.45e0 SMART
LRR 623 648 4.65e-1 SMART
Blast:LRR 649 680 2e-13 BLAST
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains several tandem leucine-rich repeats. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before turning of the embryo with iron overload, growth retardation, and hemorrhage. Mice heterozygous for a knock-out allele exhibit abnormal iron homeostasis when fed a low iron diet. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G T X: 70,394,514 Q58K possibly damaging Het
9130409I23Rik A G 1: 181,054,793 D40G probably damaging Het
Aamdc T C 7: 97,565,243 M42V probably benign Het
Abca6 T A 11: 110,184,133 Q1368L probably damaging Het
Best3 G A 10: 117,004,426 G254R probably damaging Het
Cacna1h A T 17: 25,383,723 I1478N probably damaging Het
Ccdc113 T A 8: 95,558,738 M350K possibly damaging Het
Cdc42bpa A T 1: 180,069,319 H389L probably damaging Het
Cnn3 G T 3: 121,455,069 M208I probably damaging Het
Col11a1 A G 3: 114,097,049 D345G unknown Het
Dnah14 G T 1: 181,755,288 V3131F probably damaging Het
Dst T A 1: 34,191,852 M2842K probably benign Het
Dus3l C T 17: 56,767,058 Q211* probably null Het
Eftud2 A G 11: 102,867,859 F171S probably benign Het
Elac2 T C 11: 64,980,614 I117T probably benign Het
Fam13b A G 18: 34,473,633 C302R possibly damaging Het
Fhdc1 A G 3: 84,451,483 S370P probably damaging Het
Gm35911 A G 5: 99,924,926 I111V probably benign Het
Gtf3c6 T C 10: 40,257,473 probably null Het
I830077J02Rik A G 3: 105,927,998 V21A probably benign Het
Inf2 G T 12: 112,601,640 E209* probably null Het
Irs1 A T 1: 82,289,739 M252K probably damaging Het
Kcng3 C A 17: 83,631,087 V178L probably damaging Het
Kif16b A C 2: 142,901,365 S3A probably benign Het
Kit T C 5: 75,652,805 M884T probably damaging Het
Kmt2a A T 9: 44,819,290 probably benign Het
Kptn T C 7: 16,123,976 I243T probably benign Het
Loxhd1 G A 18: 77,380,496 E947K possibly damaging Het
Lyl1 A T 8: 84,702,847 I62L probably damaging Het
Mmp24 C T 2: 155,814,045 R468* probably null Het
Mrvi1 A G 7: 110,899,672 probably null Het
Mtx2 G A 2: 74,876,370 D230N probably benign Het
Ndufa5 A T 6: 24,522,758 Y28* probably null Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Nrxn3 A G 12: 90,204,664 N923S probably benign Het
Ogfod2 C T 5: 124,113,475 T116M possibly damaging Het
Olfr1220 A G 2: 89,097,843 V28A probably benign Het
Olfr492 T A 7: 108,322,906 T257S probably benign Het
Olfr835 A T 9: 19,035,575 I151F probably benign Het
Olfr846 A C 9: 19,361,208 V49G probably damaging Het
Oosp1 T C 19: 11,667,754 E182G possibly damaging Het
Oxnad1 C A 14: 32,092,091 T47K possibly damaging Het
Pcdha5 A G 18: 36,962,738 M767V possibly damaging Het
Pcnx3 A T 19: 5,665,745 H1444Q probably benign Het
Pde4dip G T 3: 97,696,993 Q2224K probably benign Het
Pgr A T 9: 8,956,340 H763L possibly damaging Het
Plec T C 15: 76,174,310 D3809G probably damaging Het
Ppfia1 A G 7: 144,520,693 S155P probably damaging Het
Ppfia4 A G 1: 134,300,528 V1090A probably benign Het
Ptgdr T C 14: 44,858,685 E190G probably benign Het
Rhbdd2 T A 5: 135,636,335 C173* probably null Het
Rhobtb1 C A 10: 69,266,290 P134T probably damaging Het
Slc25a36 A T 9: 97,080,452 F161L probably benign Het
Slc5a11 A G 7: 123,269,976 T596A probably benign Het
Slco1a6 T C 6: 142,089,900 Y566C probably damaging Het
Snx15 T G 19: 6,119,915 K321T probably damaging Het
Snx15 T C 19: 6,119,916 K321E probably damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Syt8 T C 7: 142,438,268 I32T probably benign Het
Thumpd1 T C 7: 119,720,585 N53D possibly damaging Het
Timm21 T C 18: 84,951,138 T54A probably benign Het
Tmed10 A G 12: 85,344,317 V149A probably damaging Het
Tmem108 T A 9: 103,499,885 M122L probably benign Het
Tram1l1 A G 3: 124,321,787 I199V probably benign Het
Tspan8 A G 10: 115,839,897 N156S probably benign Het
Vars T C 17: 35,011,504 V521A probably benign Het
Vmn2r54 G T 7: 12,615,816 T613N possibly damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Vps33a T C 5: 123,533,952 K451R probably benign Het
Vsig10l T C 7: 43,463,729 I35T probably benign Het
Xpnpep3 T A 15: 81,448,459 L399Q probably damaging Het
Zfp438 T C 18: 5,214,013 E315G probably benign Het
Zfp467 C T 6: 48,439,334 G128D probably damaging Het
Other mutations in Fbxl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fbxl5 APN 5 43765336 missense probably damaging 1.00
IGL00797:Fbxl5 APN 5 43758401 missense probably damaging 1.00
IGL00811:Fbxl5 APN 5 43758225 missense probably damaging 1.00
IGL01065:Fbxl5 APN 5 43745334 missense probably damaging 1.00
IGL01626:Fbxl5 APN 5 43758705 missense probably benign 0.00
IGL02285:Fbxl5 APN 5 43765348 missense possibly damaging 0.88
D3080:Fbxl5 UTSW 5 43758366 missense probably benign 0.00
PIT4498001:Fbxl5 UTSW 5 43750981 missense possibly damaging 0.73
R0195:Fbxl5 UTSW 5 43770798 missense probably damaging 1.00
R0647:Fbxl5 UTSW 5 43768069 missense probably damaging 0.98
R1540:Fbxl5 UTSW 5 43758636 missense possibly damaging 0.92
R1545:Fbxl5 UTSW 5 43770798 missense probably damaging 1.00
R1569:Fbxl5 UTSW 5 43765461 missense probably damaging 1.00
R1921:Fbxl5 UTSW 5 43765490 missense probably benign 0.16
R3081:Fbxl5 UTSW 5 43750880 missense probably damaging 1.00
R3776:Fbxl5 UTSW 5 43758276 missense possibly damaging 0.57
R4096:Fbxl5 UTSW 5 43758241 missense probably benign 0.19
R4275:Fbxl5 UTSW 5 43762772 intron probably benign
R4383:Fbxl5 UTSW 5 43762963 intron probably benign
R4469:Fbxl5 UTSW 5 43768186 missense probably damaging 1.00
R4654:Fbxl5 UTSW 5 43765429 missense probably damaging 0.99
R5067:Fbxl5 UTSW 5 43758772 missense probably benign 0.00
R5093:Fbxl5 UTSW 5 43773554 missense probably damaging 1.00
R5696:Fbxl5 UTSW 5 43758840 missense possibly damaging 0.93
R5738:Fbxl5 UTSW 5 43762828 missense probably benign 0.30
R6029:Fbxl5 UTSW 5 43765404 missense probably damaging 0.96
R6185:Fbxl5 UTSW 5 43821552 missense probably benign 0.02
R6842:Fbxl5 UTSW 5 43773586 missense probably damaging 1.00
R7234:Fbxl5 UTSW 5 43758220 missense probably benign 0.08
R7563:Fbxl5 UTSW 5 43821549 missense probably benign 0.00
R7653:Fbxl5 UTSW 5 43758774 missense probably benign
R7842:Fbxl5 UTSW 5 43758603 missense probably damaging 1.00
R7860:Fbxl5 UTSW 5 43758676 missense probably benign 0.00
R8393:Fbxl5 UTSW 5 43768091 missense possibly damaging 0.94
RF012:Fbxl5 UTSW 5 43773505 missense probably damaging 1.00
X0065:Fbxl5 UTSW 5 43760798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTACTGTAACAACCAGATGAGG -3'
(R):5'- CGGCATCTTGATCTGTCTGG -3'

Sequencing Primer
(F):5'- CAAAGTTGGAGGCTGTTTCCATCAC -3'
(R):5'- GCATCTTGATCTGTCTGGATGTG -3'
Posted On2020-06-30