Incidental Mutation 'R8139:Kit'
ID 632400
Institutional Source Beutler Lab
Gene Symbol Kit
Ensembl Gene ENSMUSG00000005672
Gene Name KIT proto-oncogene receptor tyrosine kinase
Synonyms Gsfsco1, CD117, SCO1, Gsfsow3, belly-spot, SCO5, SOW3, Tr-kit, c-KIT, Steel Factor Receptor, Gsfsco5, Dominant white spotting
MMRRC Submission 067567-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.953) question?
Stock # R8139 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 75735647-75817382 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75813465 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 884 (M884T)
Ref Sequence ENSEMBL: ENSMUSP00000005815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005815] [ENSMUST00000144270]
AlphaFold P05532
PDB Structure Structure of a class III RTK signaling assembly [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000005815
AA Change: M884T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000005815
Gene: ENSMUSG00000005672
AA Change: M884T

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
IG 43 113 3.02e0 SMART
IG_like 122 206 1.09e2 SMART
IGc2 225 300 3.79e-4 SMART
IG 323 413 1.21e-2 SMART
IG_like 429 501 1.88e0 SMART
transmembrane domain 524 546 N/A INTRINSIC
TyrKc 592 926 2.5e-138 SMART
low complexity region 945 963 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144270
AA Change: M880T

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116465
Gene: ENSMUSG00000005672
AA Change: M880T

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 22 30 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
IG 55 125 3.02e0 SMART
IG_like 134 218 1.09e2 SMART
IGc2 237 312 3.79e-4 SMART
IG 335 425 1.21e-2 SMART
IG_like 441 513 1.88e0 SMART
transmembrane domain 532 554 N/A INTRINSIC
TyrKc 600 934 2.5e-138 SMART
low complexity region 953 971 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G T X: 69,438,120 (GRCm39) Q58K possibly damaging Het
Aamdc T C 7: 97,214,450 (GRCm39) M42V probably benign Het
Abca6 T A 11: 110,074,959 (GRCm39) Q1368L probably damaging Het
Best3 G A 10: 116,840,331 (GRCm39) G254R probably damaging Het
Cacna1h A T 17: 25,602,697 (GRCm39) I1478N probably damaging Het
Ccdc113 T A 8: 96,285,366 (GRCm39) M350K possibly damaging Het
Cdc42bpa A T 1: 179,896,884 (GRCm39) H389L probably damaging Het
Cnn3 G T 3: 121,248,718 (GRCm39) M208I probably damaging Het
Col11a1 A G 3: 113,890,698 (GRCm39) D345G unknown Het
Degs1l A G 1: 180,882,358 (GRCm39) D40G probably damaging Het
Dnah14 G T 1: 181,582,853 (GRCm39) V3131F probably damaging Het
Dst T A 1: 34,230,933 (GRCm39) M2842K probably benign Het
Dus3l C T 17: 57,074,058 (GRCm39) Q211* probably null Het
Eftud2 A G 11: 102,758,685 (GRCm39) F171S probably benign Het
Elac2 T C 11: 64,871,440 (GRCm39) I117T probably benign Het
Fam13b A G 18: 34,606,686 (GRCm39) C302R possibly damaging Het
Fbxl5 G A 5: 43,916,087 (GRCm39) Q442* probably null Het
Fhdc1 A G 3: 84,358,790 (GRCm39) S370P probably damaging Het
Gtf3c6 T C 10: 40,133,469 (GRCm39) probably null Het
I830077J02Rik A G 3: 105,835,314 (GRCm39) V21A probably benign Het
Inf2 G T 12: 112,568,074 (GRCm39) E209* probably null Het
Irag1 A G 7: 110,498,879 (GRCm39) probably null Het
Irs1 A T 1: 82,267,460 (GRCm39) M252K probably damaging Het
Kcng3 C A 17: 83,938,516 (GRCm39) V178L probably damaging Het
Kif16b A C 2: 142,743,285 (GRCm39) S3A probably benign Het
Kmt2a A T 9: 44,730,587 (GRCm39) probably benign Het
Kptn T C 7: 15,857,901 (GRCm39) I243T probably benign Het
Loxhd1 G A 18: 77,468,192 (GRCm39) E947K possibly damaging Het
Lyl1 A T 8: 85,429,476 (GRCm39) I62L probably damaging Het
Mmp24 C T 2: 155,655,965 (GRCm39) R468* probably null Het
Mtx2 G A 2: 74,706,714 (GRCm39) D230N probably benign Het
Ndufa5 A T 6: 24,522,757 (GRCm39) Y28* probably null Het
Notch4 G T 17: 34,803,774 (GRCm39) E1515* probably null Het
Nrxn3 A G 12: 90,171,438 (GRCm39) N923S probably benign Het
Ogfod2 C T 5: 124,251,538 (GRCm39) T116M possibly damaging Het
Oosp1 T C 19: 11,645,118 (GRCm39) E182G possibly damaging Het
Or4c115 A G 2: 88,928,187 (GRCm39) V28A probably benign Het
Or5p67 T A 7: 107,922,113 (GRCm39) T257S probably benign Het
Or7g20 A T 9: 18,946,871 (GRCm39) I151F probably benign Het
Or7g28 A C 9: 19,272,504 (GRCm39) V49G probably damaging Het
Oxnad1 C A 14: 31,814,048 (GRCm39) T47K possibly damaging Het
Pcdha5 A G 18: 37,095,791 (GRCm39) M767V possibly damaging Het
Pcnx3 A T 19: 5,715,773 (GRCm39) H1444Q probably benign Het
Pde4dip G T 3: 97,604,309 (GRCm39) Q2224K probably benign Het
Pgr A T 9: 8,956,341 (GRCm39) H763L possibly damaging Het
Plec T C 15: 76,058,510 (GRCm39) D3809G probably damaging Het
Ppfia1 A G 7: 144,074,430 (GRCm39) S155P probably damaging Het
Ppfia4 A G 1: 134,228,266 (GRCm39) V1090A probably benign Het
Ptgdr T C 14: 45,096,142 (GRCm39) E190G probably benign Het
Rhbdd2 T A 5: 135,665,189 (GRCm39) C173* probably null Het
Rhobtb1 C A 10: 69,102,120 (GRCm39) P134T probably damaging Het
Slc25a36 A T 9: 96,962,505 (GRCm39) F161L probably benign Het
Slc5a11 A G 7: 122,869,199 (GRCm39) T596A probably benign Het
Slco1a6 T C 6: 142,035,626 (GRCm39) Y566C probably damaging Het
Snx15 T G 19: 6,169,945 (GRCm39) K321T probably damaging Het
Snx15 T C 19: 6,169,946 (GRCm39) K321E probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Syt8 T C 7: 141,992,005 (GRCm39) I32T probably benign Het
Thumpd1 T C 7: 119,319,808 (GRCm39) N53D possibly damaging Het
Timm21 T C 18: 84,969,263 (GRCm39) T54A probably benign Het
Tmed10 A G 12: 85,391,091 (GRCm39) V149A probably damaging Het
Tmem108 T A 9: 103,377,084 (GRCm39) M122L probably benign Het
Tram1l1 A G 3: 124,115,436 (GRCm39) I199V probably benign Het
Tspan8 A G 10: 115,675,802 (GRCm39) N156S probably benign Het
Vamp9 A G 5: 100,072,785 (GRCm39) I111V probably benign Het
Vars1 T C 17: 35,230,480 (GRCm39) V521A probably benign Het
Vmn2r54 G T 7: 12,349,743 (GRCm39) T613N possibly damaging Het
Vps13b T A 15: 35,607,418 (GRCm39) L1117* probably null Het
Vps33a T C 5: 123,672,015 (GRCm39) K451R probably benign Het
Vsig10l T C 7: 43,113,153 (GRCm39) I35T probably benign Het
Xpnpep3 T A 15: 81,332,660 (GRCm39) L399Q probably damaging Het
Zfp438 T C 18: 5,214,013 (GRCm39) E315G probably benign Het
Zfp467 C T 6: 48,416,268 (GRCm39) G128D probably damaging Het
Other mutations in Kit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kit APN 5 75,771,479 (GRCm39) missense probably benign 0.00
IGL00834:Kit APN 5 75,806,619 (GRCm39) missense probably damaging 1.00
IGL00846:Kit APN 5 75,801,471 (GRCm39) missense probably damaging 0.98
IGL01149:Kit APN 5 75,771,536 (GRCm39) missense probably damaging 0.97
IGL01341:Kit APN 5 75,767,734 (GRCm39) missense probably damaging 1.00
IGL02004:Kit APN 5 75,781,674 (GRCm39) missense probably benign
IGL02281:Kit APN 5 75,815,194 (GRCm39) missense possibly damaging 0.66
IGL02424:Kit APN 5 75,799,766 (GRCm39) missense probably benign
IGL02697:Kit APN 5 75,767,919 (GRCm39) missense probably benign
IGL02929:Kit APN 5 75,801,429 (GRCm39) missense probably damaging 1.00
IGL03053:Kit APN 5 75,771,574 (GRCm39) missense probably benign
IGL03127:Kit APN 5 75,801,848 (GRCm39) missense probably benign 0.44
IGL03174:Kit APN 5 75,767,773 (GRCm39) missense probably benign
IGL03381:Kit APN 5 75,767,788 (GRCm39) missense probably benign 0.04
casper UTSW 5 75,806,535 (GRCm39) missense probably damaging 1.00
Mooyah2 UTSW 5 75,813,468 (GRCm39) missense probably damaging 1.00
pretty2 UTSW 5 75,810,210 (GRCm39) missense probably damaging 1.00
slimmer UTSW 5 75,801,417 (GRCm39) missense possibly damaging 0.94
IGL02837:Kit UTSW 5 75,799,668 (GRCm39) missense probably benign 0.00
R0022:Kit UTSW 5 75,783,657 (GRCm39) missense probably benign 0.00
R0022:Kit UTSW 5 75,783,657 (GRCm39) missense probably benign 0.00
R0092:Kit UTSW 5 75,808,414 (GRCm39) missense possibly damaging 0.93
R0254:Kit UTSW 5 75,781,581 (GRCm39) missense probably benign
R0329:Kit UTSW 5 75,813,489 (GRCm39) missense probably damaging 1.00
R0609:Kit UTSW 5 75,771,539 (GRCm39) missense probably benign 0.35
R1068:Kit UTSW 5 75,770,178 (GRCm39) missense probably benign
R1115:Kit UTSW 5 75,810,192 (GRCm39) splice site probably benign
R1480:Kit UTSW 5 75,797,977 (GRCm39) missense probably benign 0.00
R1639:Kit UTSW 5 75,813,467 (GRCm39) missense probably damaging 1.00
R1801:Kit UTSW 5 75,809,053 (GRCm39) missense probably damaging 1.00
R1973:Kit UTSW 5 75,776,102 (GRCm39) missense probably damaging 1.00
R2033:Kit UTSW 5 75,797,977 (GRCm39) missense possibly damaging 0.88
R3125:Kit UTSW 5 75,808,488 (GRCm39) missense probably null 0.00
R3125:Kit UTSW 5 75,808,487 (GRCm39) missense probably benign 0.07
R3437:Kit UTSW 5 75,806,565 (GRCm39) missense probably damaging 1.00
R3791:Kit UTSW 5 75,799,810 (GRCm39) missense probably damaging 1.00
R3939:Kit UTSW 5 75,769,978 (GRCm39) missense probably benign 0.00
R3940:Kit UTSW 5 75,769,978 (GRCm39) missense probably benign 0.00
R3941:Kit UTSW 5 75,769,978 (GRCm39) missense probably benign 0.00
R3942:Kit UTSW 5 75,769,978 (GRCm39) missense probably benign 0.00
R4092:Kit UTSW 5 75,771,470 (GRCm39) missense probably benign 0.28
R4376:Kit UTSW 5 75,801,159 (GRCm39) missense probably benign 0.00
R4377:Kit UTSW 5 75,801,159 (GRCm39) missense probably benign 0.00
R4668:Kit UTSW 5 75,801,880 (GRCm39) splice site probably null
R5104:Kit UTSW 5 75,776,138 (GRCm39) missense probably benign 0.00
R5152:Kit UTSW 5 75,781,507 (GRCm39) missense probably benign 0.00
R5154:Kit UTSW 5 75,801,200 (GRCm39) missense probably damaging 0.99
R5508:Kit UTSW 5 75,810,208 (GRCm39) missense probably damaging 1.00
R5624:Kit UTSW 5 75,770,054 (GRCm39) missense probably benign 0.40
R5731:Kit UTSW 5 75,815,075 (GRCm39) missense possibly damaging 0.93
R6270:Kit UTSW 5 75,770,169 (GRCm39) missense probably benign
R6565:Kit UTSW 5 75,806,513 (GRCm39) missense probably damaging 1.00
R6694:Kit UTSW 5 75,801,417 (GRCm39) missense possibly damaging 0.94
R6805:Kit UTSW 5 75,813,468 (GRCm39) missense probably damaging 1.00
R6823:Kit UTSW 5 75,813,309 (GRCm39) missense probably benign 0.01
R6848:Kit UTSW 5 75,767,872 (GRCm39) missense probably benign
R7021:Kit UTSW 5 75,781,627 (GRCm39) missense probably benign 0.00
R7080:Kit UTSW 5 75,767,941 (GRCm39) missense probably damaging 0.99
R7117:Kit UTSW 5 75,767,758 (GRCm39) missense probably benign 0.18
R7156:Kit UTSW 5 75,776,034 (GRCm39) missense probably benign 0.14
R7379:Kit UTSW 5 75,808,412 (GRCm39) missense probably damaging 1.00
R7427:Kit UTSW 5 75,806,507 (GRCm39) missense possibly damaging 0.92
R7438:Kit UTSW 5 75,799,660 (GRCm39) missense probably benign 0.01
R7531:Kit UTSW 5 75,767,700 (GRCm39) missense probably damaging 0.99
R7711:Kit UTSW 5 75,798,019 (GRCm39) missense probably damaging 0.97
R7810:Kit UTSW 5 75,769,982 (GRCm39) missense probably benign 0.11
R7819:Kit UTSW 5 75,806,592 (GRCm39) missense probably benign 0.41
R8021:Kit UTSW 5 75,776,151 (GRCm39) missense possibly damaging 0.79
R8165:Kit UTSW 5 75,781,540 (GRCm39) missense possibly damaging 0.94
R8249:Kit UTSW 5 75,802,068 (GRCm39) missense probably damaging 0.97
R8288:Kit UTSW 5 75,815,149 (GRCm39) missense probably damaging 1.00
R8290:Kit UTSW 5 75,801,829 (GRCm39) missense probably benign
R8829:Kit UTSW 5 75,799,791 (GRCm39) missense probably benign 0.41
R8832:Kit UTSW 5 75,799,791 (GRCm39) missense probably benign 0.41
R8969:Kit UTSW 5 75,799,722 (GRCm39) missense
R9081:Kit UTSW 5 75,801,218 (GRCm39) missense probably benign
R9146:Kit UTSW 5 75,810,305 (GRCm39) missense probably damaging 1.00
R9232:Kit UTSW 5 75,799,792 (GRCm39) missense probably benign 0.00
R9631:Kit UTSW 5 75,767,689 (GRCm39) missense possibly damaging 0.95
U24488:Kit UTSW 5 75,783,674 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGCTGCGTGTACACATTTG -3'
(R):5'- CCACAGCCATGACATTTGAG -3'

Sequencing Primer
(F):5'- CACATTTGAAAGTGATGTCTGGTCC -3'
(R):5'- CATGACATTTGAGCGCGG -3'
Posted On 2020-06-30