Incidental Mutation 'R8139:Vps33a'
ID 632402
Institutional Source Beutler Lab
Gene Symbol Vps33a
Ensembl Gene ENSMUSG00000029434
Gene Name VPS33A CORVET/HOPS core subunit
Synonyms 3830421M04Rik, bf
MMRRC Submission 067567-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8139 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 123666820-123711104 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123672015 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 451 (K451R)
Ref Sequence ENSEMBL: ENSMUSP00000031388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031388]
AlphaFold Q9D2N9
Predicted Effect probably benign
Transcript: ENSMUST00000031388
AA Change: K451R

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434
AA Change: K451R

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:Sec1 34 592 7.2e-104 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and it encodes a protein similar to the yeast class C Vps33 protein. The mammalian class C VPS proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce hypopigmentation, an extended bleeeding time and abnormal kidney function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G T X: 69,438,120 (GRCm39) Q58K possibly damaging Het
Aamdc T C 7: 97,214,450 (GRCm39) M42V probably benign Het
Abca6 T A 11: 110,074,959 (GRCm39) Q1368L probably damaging Het
Best3 G A 10: 116,840,331 (GRCm39) G254R probably damaging Het
Cacna1h A T 17: 25,602,697 (GRCm39) I1478N probably damaging Het
Ccdc113 T A 8: 96,285,366 (GRCm39) M350K possibly damaging Het
Cdc42bpa A T 1: 179,896,884 (GRCm39) H389L probably damaging Het
Cnn3 G T 3: 121,248,718 (GRCm39) M208I probably damaging Het
Col11a1 A G 3: 113,890,698 (GRCm39) D345G unknown Het
Degs1l A G 1: 180,882,358 (GRCm39) D40G probably damaging Het
Dnah14 G T 1: 181,582,853 (GRCm39) V3131F probably damaging Het
Dst T A 1: 34,230,933 (GRCm39) M2842K probably benign Het
Dus3l C T 17: 57,074,058 (GRCm39) Q211* probably null Het
Eftud2 A G 11: 102,758,685 (GRCm39) F171S probably benign Het
Elac2 T C 11: 64,871,440 (GRCm39) I117T probably benign Het
Fam13b A G 18: 34,606,686 (GRCm39) C302R possibly damaging Het
Fbxl5 G A 5: 43,916,087 (GRCm39) Q442* probably null Het
Fhdc1 A G 3: 84,358,790 (GRCm39) S370P probably damaging Het
Gtf3c6 T C 10: 40,133,469 (GRCm39) probably null Het
I830077J02Rik A G 3: 105,835,314 (GRCm39) V21A probably benign Het
Inf2 G T 12: 112,568,074 (GRCm39) E209* probably null Het
Irag1 A G 7: 110,498,879 (GRCm39) probably null Het
Irs1 A T 1: 82,267,460 (GRCm39) M252K probably damaging Het
Kcng3 C A 17: 83,938,516 (GRCm39) V178L probably damaging Het
Kif16b A C 2: 142,743,285 (GRCm39) S3A probably benign Het
Kit T C 5: 75,813,465 (GRCm39) M884T probably damaging Het
Kmt2a A T 9: 44,730,587 (GRCm39) probably benign Het
Kptn T C 7: 15,857,901 (GRCm39) I243T probably benign Het
Loxhd1 G A 18: 77,468,192 (GRCm39) E947K possibly damaging Het
Lyl1 A T 8: 85,429,476 (GRCm39) I62L probably damaging Het
Mmp24 C T 2: 155,655,965 (GRCm39) R468* probably null Het
Mtx2 G A 2: 74,706,714 (GRCm39) D230N probably benign Het
Ndufa5 A T 6: 24,522,757 (GRCm39) Y28* probably null Het
Notch4 G T 17: 34,803,774 (GRCm39) E1515* probably null Het
Nrxn3 A G 12: 90,171,438 (GRCm39) N923S probably benign Het
Ogfod2 C T 5: 124,251,538 (GRCm39) T116M possibly damaging Het
Oosp1 T C 19: 11,645,118 (GRCm39) E182G possibly damaging Het
Or4c115 A G 2: 88,928,187 (GRCm39) V28A probably benign Het
Or5p67 T A 7: 107,922,113 (GRCm39) T257S probably benign Het
Or7g20 A T 9: 18,946,871 (GRCm39) I151F probably benign Het
Or7g28 A C 9: 19,272,504 (GRCm39) V49G probably damaging Het
Oxnad1 C A 14: 31,814,048 (GRCm39) T47K possibly damaging Het
Pcdha5 A G 18: 37,095,791 (GRCm39) M767V possibly damaging Het
Pcnx3 A T 19: 5,715,773 (GRCm39) H1444Q probably benign Het
Pde4dip G T 3: 97,604,309 (GRCm39) Q2224K probably benign Het
Pgr A T 9: 8,956,341 (GRCm39) H763L possibly damaging Het
Plec T C 15: 76,058,510 (GRCm39) D3809G probably damaging Het
Ppfia1 A G 7: 144,074,430 (GRCm39) S155P probably damaging Het
Ppfia4 A G 1: 134,228,266 (GRCm39) V1090A probably benign Het
Ptgdr T C 14: 45,096,142 (GRCm39) E190G probably benign Het
Rhbdd2 T A 5: 135,665,189 (GRCm39) C173* probably null Het
Rhobtb1 C A 10: 69,102,120 (GRCm39) P134T probably damaging Het
Slc25a36 A T 9: 96,962,505 (GRCm39) F161L probably benign Het
Slc5a11 A G 7: 122,869,199 (GRCm39) T596A probably benign Het
Slco1a6 T C 6: 142,035,626 (GRCm39) Y566C probably damaging Het
Snx15 T G 19: 6,169,945 (GRCm39) K321T probably damaging Het
Snx15 T C 19: 6,169,946 (GRCm39) K321E probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Syt8 T C 7: 141,992,005 (GRCm39) I32T probably benign Het
Thumpd1 T C 7: 119,319,808 (GRCm39) N53D possibly damaging Het
Timm21 T C 18: 84,969,263 (GRCm39) T54A probably benign Het
Tmed10 A G 12: 85,391,091 (GRCm39) V149A probably damaging Het
Tmem108 T A 9: 103,377,084 (GRCm39) M122L probably benign Het
Tram1l1 A G 3: 124,115,436 (GRCm39) I199V probably benign Het
Tspan8 A G 10: 115,675,802 (GRCm39) N156S probably benign Het
Vamp9 A G 5: 100,072,785 (GRCm39) I111V probably benign Het
Vars1 T C 17: 35,230,480 (GRCm39) V521A probably benign Het
Vmn2r54 G T 7: 12,349,743 (GRCm39) T613N possibly damaging Het
Vps13b T A 15: 35,607,418 (GRCm39) L1117* probably null Het
Vsig10l T C 7: 43,113,153 (GRCm39) I35T probably benign Het
Xpnpep3 T A 15: 81,332,660 (GRCm39) L399Q probably damaging Het
Zfp438 T C 18: 5,214,013 (GRCm39) E315G probably benign Het
Zfp467 C T 6: 48,416,268 (GRCm39) G128D probably damaging Het
Other mutations in Vps33a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Vps33a APN 5 123,711,006 (GRCm39) missense probably benign 0.00
IGL01459:Vps33a APN 5 123,673,371 (GRCm39) missense probably benign 0.08
IGL02473:Vps33a APN 5 123,707,634 (GRCm39) missense probably damaging 1.00
IGL02899:Vps33a APN 5 123,669,239 (GRCm39) missense probably damaging 1.00
R0498:Vps33a UTSW 5 123,709,024 (GRCm39) missense probably benign 0.40
R1134:Vps33a UTSW 5 123,708,975 (GRCm39) missense probably damaging 0.97
R1928:Vps33a UTSW 5 123,696,684 (GRCm39) missense probably benign 0.02
R2012:Vps33a UTSW 5 123,669,244 (GRCm39) splice site probably null
R2926:Vps33a UTSW 5 123,707,634 (GRCm39) missense possibly damaging 0.83
R3688:Vps33a UTSW 5 123,673,274 (GRCm39) splice site probably null
R3872:Vps33a UTSW 5 123,669,255 (GRCm39) missense probably benign 0.16
R4437:Vps33a UTSW 5 123,669,947 (GRCm39) missense probably benign
R5153:Vps33a UTSW 5 123,696,691 (GRCm39) missense probably damaging 1.00
R5396:Vps33a UTSW 5 123,696,693 (GRCm39) missense probably damaging 0.98
R5686:Vps33a UTSW 5 123,685,064 (GRCm39) critical splice donor site probably null
R5714:Vps33a UTSW 5 123,707,563 (GRCm39) missense probably benign
R5814:Vps33a UTSW 5 123,703,119 (GRCm39) missense probably damaging 1.00
R6845:Vps33a UTSW 5 123,673,335 (GRCm39) missense probably benign 0.02
R7183:Vps33a UTSW 5 123,673,278 (GRCm39) missense probably null 0.83
R7359:Vps33a UTSW 5 123,696,696 (GRCm39) missense probably benign 0.00
R7593:Vps33a UTSW 5 123,674,619 (GRCm39) missense probably benign 0.00
R7855:Vps33a UTSW 5 123,709,042 (GRCm39) missense possibly damaging 0.78
R7885:Vps33a UTSW 5 123,673,312 (GRCm39) missense possibly damaging 0.70
R8025:Vps33a UTSW 5 123,696,738 (GRCm39) missense possibly damaging 0.76
R8275:Vps33a UTSW 5 123,707,522 (GRCm39) missense probably damaging 0.99
R8434:Vps33a UTSW 5 123,671,944 (GRCm39) missense possibly damaging 0.74
R8845:Vps33a UTSW 5 123,709,538 (GRCm39) critical splice donor site probably null
R8879:Vps33a UTSW 5 123,671,962 (GRCm39) missense probably damaging 1.00
R8880:Vps33a UTSW 5 123,707,506 (GRCm39) missense probably damaging 0.98
R9172:Vps33a UTSW 5 123,674,604 (GRCm39) missense probably benign 0.17
R9440:Vps33a UTSW 5 123,703,047 (GRCm39) missense probably damaging 1.00
R9502:Vps33a UTSW 5 123,696,705 (GRCm39) missense probably benign 0.00
R9725:Vps33a UTSW 5 123,669,135 (GRCm39) missense possibly damaging 0.95
X0026:Vps33a UTSW 5 123,685,160 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ACACACATGCACTGCTTTGC -3'
(R):5'- CAAGAGTCTCAGCGTGAGTG -3'

Sequencing Primer
(F):5'- GGAACCAACTCCTGCAGGTTTC -3'
(R):5'- GCACTCTCCACTCTCAGGG -3'
Posted On 2020-06-30