Mutagenetix > Incidental Mutations

Incidental Mutation 'R8139:Vps33a'

632402

Institutional Source

Beutler Lab

Gene Symbol

Vps33a

Ensembl Gene

ENSMUSG00000029434

Gene Name

VPS33A CORVET/HOPS core subunit

Synonyms

3830421M04Rik, bf

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8139 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123528659-123573038 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123533952 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 451 (K451R)

Ref Sequence

ENSEMBL: ENSMUSP00000031388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031388]

Predicted Effect

probably benign
Transcript: ENSMUST00000031388
AA Change: K451R

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434
AA Change: K451R

Domain	Start	End	E-Value	Type
low complexity region	12	27	N/A	INTRINSIC
Pfam:Sec1	34	592	7.2e-104	PFAM

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 94.2%

Validation Efficiency

100% (84/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and it encodes a protein similar to the yeast class C Vps33 protein. The mammalian class C VPS proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce hypopigmentation, an extended bleeeding time and abnormal kidney function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	G	T	X: 70,394,514	Q58K	possibly damaging	Het
9130409I23Rik	A	G	1: 181,054,793	D40G	probably damaging	Het
Aamdc	T	C	7: 97,565,243	M42V	probably benign	Het
Abca6	T	A	11: 110,184,133	Q1368L	probably damaging	Het
Best3	G	A	10: 117,004,426	G254R	probably damaging	Het
Cacna1h	A	T	17: 25,383,723	I1478N	probably damaging	Het
Ccdc113	T	A	8: 95,558,738	M350K	possibly damaging	Het
Cdc42bpa	A	T	1: 180,069,319	H389L	probably damaging	Het
Cnn3	G	T	3: 121,455,069	M208I	probably damaging	Het
Col11a1	A	G	3: 114,097,049	D345G	unknown	Het
Dnah14	G	T	1: 181,755,288	V3131F	probably damaging	Het
Dst	T	A	1: 34,191,852	M2842K	probably benign	Het
Dus3l	C	T	17: 56,767,058	Q211*	probably null	Het
Eftud2	A	G	11: 102,867,859	F171S	probably benign	Het
Elac2	T	C	11: 64,980,614	I117T	probably benign	Het
Fam13b	A	G	18: 34,473,633	C302R	possibly damaging	Het
Fbxl5	G	A	5: 43,758,745	Q442*	probably null	Het
Fhdc1	A	G	3: 84,451,483	S370P	probably damaging	Het
Gm35911	A	G	5: 99,924,926	I111V	probably benign	Het
Gtf3c6	T	C	10: 40,257,473		probably null	Het
I830077J02Rik	A	G	3: 105,927,998	V21A	probably benign	Het
Inf2	G	T	12: 112,601,640	E209*	probably null	Het
Irs1	A	T	1: 82,289,739	M252K	probably damaging	Het
Kcng3	C	A	17: 83,631,087	V178L	probably damaging	Het
Kif16b	A	C	2: 142,901,365	S3A	probably benign	Het
Kit	T	C	5: 75,652,805	M884T	probably damaging	Het
Kmt2a	A	T	9: 44,819,290		probably benign	Het
Kptn	T	C	7: 16,123,976	I243T	probably benign	Het
Loxhd1	G	A	18: 77,380,496	E947K	possibly damaging	Het
Lyl1	A	T	8: 84,702,847	I62L	probably damaging	Het
Mmp24	C	T	2: 155,814,045	R468*	probably null	Het
Mrvi1	A	G	7: 110,899,672		probably null	Het
Mtx2	G	A	2: 74,876,370	D230N	probably benign	Het
Ndufa5	A	T	6: 24,522,758	Y28*	probably null	Het
Notch4	G	T	17: 34,584,800	E1515*	probably null	Het
Nrxn3	A	G	12: 90,204,664	N923S	probably benign	Het
Ogfod2	C	T	5: 124,113,475	T116M	possibly damaging	Het
Olfr1220	A	G	2: 89,097,843	V28A	probably benign	Het
Olfr492	T	A	7: 108,322,906	T257S	probably benign	Het
Olfr835	A	T	9: 19,035,575	I151F	probably benign	Het
Olfr846	A	C	9: 19,361,208	V49G	probably damaging	Het
Oosp1	T	C	19: 11,667,754	E182G	possibly damaging	Het
Oxnad1	C	A	14: 32,092,091	T47K	possibly damaging	Het
Pcdha5	A	G	18: 36,962,738	M767V	possibly damaging	Het
Pcnx3	A	T	19: 5,665,745	H1444Q	probably benign	Het
Pde4dip	G	T	3: 97,696,993	Q2224K	probably benign	Het
Pgr	A	T	9: 8,956,340	H763L	possibly damaging	Het
Plec	T	C	15: 76,174,310	D3809G	probably damaging	Het
Ppfia1	A	G	7: 144,520,693	S155P	probably damaging	Het
Ppfia4	A	G	1: 134,300,528	V1090A	probably benign	Het
Ptgdr	T	C	14: 44,858,685	E190G	probably benign	Het
Rhbdd2	T	A	5: 135,636,335	C173*	probably null	Het
Rhobtb1	C	A	10: 69,266,290	P134T	probably damaging	Het
Slc25a36	A	T	9: 97,080,452	F161L	probably benign	Het
Slc5a11	A	G	7: 123,269,976	T596A	probably benign	Het
Slco1a6	T	C	6: 142,089,900	Y566C	probably damaging	Het
Snx15	T	G	19: 6,119,915	K321T	probably damaging	Het
Snx15	T	C	19: 6,119,916	K321E	probably damaging	Het
Srebf2	C	T	15: 82,178,765	R468C	probably damaging	Het
Syt8	T	C	7: 142,438,268	I32T	probably benign	Het
Thumpd1	T	C	7: 119,720,585	N53D	possibly damaging	Het
Timm21	T	C	18: 84,951,138	T54A	probably benign	Het
Tmed10	A	G	12: 85,344,317	V149A	probably damaging	Het
Tmem108	T	A	9: 103,499,885	M122L	probably benign	Het
Tram1l1	A	G	3: 124,321,787	I199V	probably benign	Het
Tspan8	A	G	10: 115,839,897	N156S	probably benign	Het
Vars	T	C	17: 35,011,504	V521A	probably benign	Het
Vmn2r54	G	T	7: 12,615,816	T613N	possibly damaging	Het
Vps13b	T	A	15: 35,607,272	L1117*	probably null	Het
Vsig10l	T	C	7: 43,463,729	I35T	probably benign	Het
Xpnpep3	T	A	15: 81,448,459	L399Q	probably damaging	Het
Zfp438	T	C	18: 5,214,013	E315G	probably benign	Het
Zfp467	C	T	6: 48,439,334	G128D	probably damaging	Het

Other mutations in Vps33a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01345:Vps33a	APN	5	123572943	missense	probably benign	0.00
IGL01459:Vps33a	APN	5	123535308	missense	probably benign	0.08
IGL02473:Vps33a	APN	5	123569571	missense	probably damaging	1.00
IGL02899:Vps33a	APN	5	123531176	missense	probably damaging	1.00
R0498:Vps33a	UTSW	5	123570961	missense	probably benign	0.40
R1134:Vps33a	UTSW	5	123570912	missense	probably damaging	0.97
R1928:Vps33a	UTSW	5	123558621	missense	probably benign	0.02
R2012:Vps33a	UTSW	5	123531181	splice site	probably null
R2926:Vps33a	UTSW	5	123569571	missense	possibly damaging	0.83
R3688:Vps33a	UTSW	5	123535211	splice site	probably null
R3872:Vps33a	UTSW	5	123531192	missense	probably benign	0.16
R4437:Vps33a	UTSW	5	123531884	missense	probably benign
R5153:Vps33a	UTSW	5	123558628	missense	probably damaging	1.00
R5396:Vps33a	UTSW	5	123558630	missense	probably damaging	0.98
R5686:Vps33a	UTSW	5	123547001	critical splice donor site	probably null
R5714:Vps33a	UTSW	5	123569500	missense	probably benign
R5814:Vps33a	UTSW	5	123565056	missense	probably damaging	1.00
R6845:Vps33a	UTSW	5	123535272	missense	probably benign	0.02
R7183:Vps33a	UTSW	5	123535215	missense	probably null	0.83
R7359:Vps33a	UTSW	5	123558633	missense	probably benign	0.00
R7593:Vps33a	UTSW	5	123536556	missense	probably benign	0.00
R7855:Vps33a	UTSW	5	123570979	missense	possibly damaging	0.78
R7885:Vps33a	UTSW	5	123535249	missense	possibly damaging	0.70
R8025:Vps33a	UTSW	5	123558675	missense	possibly damaging	0.76
R8275:Vps33a	UTSW	5	123569459	missense	probably damaging	0.99
R8434:Vps33a	UTSW	5	123533881	missense	possibly damaging	0.74
R8845:Vps33a	UTSW	5	123571475	critical splice donor site	probably null
R8879:Vps33a	UTSW	5	123533899	missense	probably damaging	1.00
R8880:Vps33a	UTSW	5	123569443	missense	probably damaging	0.98
X0026:Vps33a	UTSW	5	123547097	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- ACACACATGCACTGCTTTGC -3'
(R):5'- CAAGAGTCTCAGCGTGAGTG -3'

Sequencing Primer
(F):5'- GGAACCAACTCCTGCAGGTTTC -3'
(R):5'- GCACTCTCCACTCTCAGGG -3'

Posted On

2020-06-30