Incidental Mutation 'R8139:Ogfod2'
ID632403
Institutional Source Beutler Lab
Gene Symbol Ogfod2
Ensembl Gene ENSMUSG00000023707
Gene Name2-oxoglutarate and iron-dependent oxygenase domain containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R8139 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location124112297-124115483 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 124113475 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 116 (T116M)
Ref Sequence ENSEMBL: ENSMUSP00000024470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024470] [ENSMUST00000031351] [ENSMUST00000119269] [ENSMUST00000122394] [ENSMUST00000145667] [ENSMUST00000149835] [ENSMUST00000196401] [ENSMUST00000196627] [ENSMUST00000198505] [ENSMUST00000198770]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024470
AA Change: T116M

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000024470
Gene: ENSMUSG00000023707
AA Change: T116M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Blast:P4Hc 42 100 2e-6 BLAST
low complexity region 102 112 N/A INTRINSIC
P4Hc 136 307 7.91e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000031351
SMART Domains Protein: ENSMUSP00000031351
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
Pfam:SR-25 7 227 2.7e-104 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119269
AA Change: T116M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112701
Gene: ENSMUSG00000023707
AA Change: T116M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Blast:P4Hc 42 133 1e-22 BLAST
Blast:P4Hc 136 175 1e-20 BLAST
low complexity region 176 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122394
SMART Domains Protein: ENSMUSP00000112506
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
Pfam:SR-25 2 199 6.3e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145667
SMART Domains Protein: ENSMUSP00000122377
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
Pfam:SR-25 19 227 3e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149835
SMART Domains Protein: ENSMUSP00000116269
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
low complexity region 5 32 N/A INTRINSIC
SCOP:d1l9ha_ 58 84 7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196401
SMART Domains Protein: ENSMUSP00000142496
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
low complexity region 29 50 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196627
AA Change: T116M

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143698
Gene: ENSMUSG00000023707
AA Change: T116M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Blast:P4Hc 42 133 1e-23 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000198505
AA Change: R110C
SMART Domains Protein: ENSMUSP00000142965
Gene: ENSMUSG00000023707
AA Change: R110C

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198770
AA Change: T85M

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143318
Gene: ENSMUSG00000023707
AA Change: T85M

DomainStartEndE-ValueType
Blast:P4Hc 11 102 7e-24 BLAST
Predicted Effect
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency 100% (84/84)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G T X: 70,394,514 Q58K possibly damaging Het
9130409I23Rik A G 1: 181,054,793 D40G probably damaging Het
Aamdc T C 7: 97,565,243 M42V probably benign Het
Abca6 T A 11: 110,184,133 Q1368L probably damaging Het
Best3 G A 10: 117,004,426 G254R probably damaging Het
Cacna1h A T 17: 25,383,723 I1478N probably damaging Het
Ccdc113 T A 8: 95,558,738 M350K possibly damaging Het
Cdc42bpa A T 1: 180,069,319 H389L probably damaging Het
Cnn3 G T 3: 121,455,069 M208I probably damaging Het
Col11a1 A G 3: 114,097,049 D345G unknown Het
Dnah14 G T 1: 181,755,288 V3131F probably damaging Het
Dst T A 1: 34,191,852 M2842K probably benign Het
Dus3l C T 17: 56,767,058 Q211* probably null Het
Eftud2 A G 11: 102,867,859 F171S probably benign Het
Elac2 T C 11: 64,980,614 I117T probably benign Het
Fam13b A G 18: 34,473,633 C302R possibly damaging Het
Fbxl5 G A 5: 43,758,745 Q442* probably null Het
Fhdc1 A G 3: 84,451,483 S370P probably damaging Het
Gm35911 A G 5: 99,924,926 I111V probably benign Het
Gtf3c6 T C 10: 40,257,473 probably null Het
I830077J02Rik A G 3: 105,927,998 V21A probably benign Het
Inf2 G T 12: 112,601,640 E209* probably null Het
Irs1 A T 1: 82,289,739 M252K probably damaging Het
Kcng3 C A 17: 83,631,087 V178L probably damaging Het
Kif16b A C 2: 142,901,365 S3A probably benign Het
Kit T C 5: 75,652,805 M884T probably damaging Het
Kmt2a A T 9: 44,819,290 probably benign Het
Kptn T C 7: 16,123,976 I243T probably benign Het
Loxhd1 G A 18: 77,380,496 E947K possibly damaging Het
Lyl1 A T 8: 84,702,847 I62L probably damaging Het
Mmp24 C T 2: 155,814,045 R468* probably null Het
Mrvi1 A G 7: 110,899,672 probably null Het
Mtx2 G A 2: 74,876,370 D230N probably benign Het
Ndufa5 A T 6: 24,522,758 Y28* probably null Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Nrxn3 A G 12: 90,204,664 N923S probably benign Het
Olfr1220 A G 2: 89,097,843 V28A probably benign Het
Olfr492 T A 7: 108,322,906 T257S probably benign Het
Olfr835 A T 9: 19,035,575 I151F probably benign Het
Olfr846 A C 9: 19,361,208 V49G probably damaging Het
Oosp1 T C 19: 11,667,754 E182G possibly damaging Het
Oxnad1 C A 14: 32,092,091 T47K possibly damaging Het
Pcdha5 A G 18: 36,962,738 M767V possibly damaging Het
Pcnx3 A T 19: 5,665,745 H1444Q probably benign Het
Pde4dip G T 3: 97,696,993 Q2224K probably benign Het
Pgr A T 9: 8,956,340 H763L possibly damaging Het
Plec T C 15: 76,174,310 D3809G probably damaging Het
Ppfia1 A G 7: 144,520,693 S155P probably damaging Het
Ppfia4 A G 1: 134,300,528 V1090A probably benign Het
Ptgdr T C 14: 44,858,685 E190G probably benign Het
Rhbdd2 T A 5: 135,636,335 C173* probably null Het
Rhobtb1 C A 10: 69,266,290 P134T probably damaging Het
Slc25a36 A T 9: 97,080,452 F161L probably benign Het
Slc5a11 A G 7: 123,269,976 T596A probably benign Het
Slco1a6 T C 6: 142,089,900 Y566C probably damaging Het
Snx15 T G 19: 6,119,915 K321T probably damaging Het
Snx15 T C 19: 6,119,916 K321E probably damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Syt8 T C 7: 142,438,268 I32T probably benign Het
Thumpd1 T C 7: 119,720,585 N53D possibly damaging Het
Timm21 T C 18: 84,951,138 T54A probably benign Het
Tmed10 A G 12: 85,344,317 V149A probably damaging Het
Tmem108 T A 9: 103,499,885 M122L probably benign Het
Tram1l1 A G 3: 124,321,787 I199V probably benign Het
Tspan8 A G 10: 115,839,897 N156S probably benign Het
Vars T C 17: 35,011,504 V521A probably benign Het
Vmn2r54 G T 7: 12,615,816 T613N possibly damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Vps33a T C 5: 123,533,952 K451R probably benign Het
Vsig10l T C 7: 43,463,729 I35T probably benign Het
Xpnpep3 T A 15: 81,448,459 L399Q probably damaging Het
Zfp438 T C 18: 5,214,013 E315G probably benign Het
Zfp467 C T 6: 48,439,334 G128D probably damaging Het
Other mutations in Ogfod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02305:Ogfod2 APN 5 124112847 critical splice donor site probably null
IGL03304:Ogfod2 APN 5 124112823 missense probably damaging 0.99
R0018:Ogfod2 UTSW 5 124114525 unclassified probably benign
R0681:Ogfod2 UTSW 5 124112844 missense probably null 1.00
R0751:Ogfod2 UTSW 5 124113476 unclassified probably benign
R1744:Ogfod2 UTSW 5 124114156 splice site probably null
R1800:Ogfod2 UTSW 5 124114956 missense probably damaging 1.00
R2211:Ogfod2 UTSW 5 124112780 splice site probably null
R3977:Ogfod2 UTSW 5 124113209 splice site probably null
R4346:Ogfod2 UTSW 5 124113294 missense probably damaging 1.00
R4508:Ogfod2 UTSW 5 124113254 nonsense probably null
R4537:Ogfod2 UTSW 5 124114528 unclassified probably benign
R5795:Ogfod2 UTSW 5 124114761 missense probably damaging 1.00
R6647:Ogfod2 UTSW 5 124114803 missense possibly damaging 0.95
R7101:Ogfod2 UTSW 5 124114495 missense unknown
R8001:Ogfod2 UTSW 5 124114883 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGGAAGGCTCTCATTGC -3'
(R):5'- TGGGAGGTAAAGCACTCAGC -3'

Sequencing Primer
(F):5'- AGCTCCTACCACCCGGCTAG -3'
(R):5'- GCCTTTAATCCTAACACTGGAGAGG -3'
Posted On2020-06-30