Incidental Mutation 'R8139:Vsig10l'
ID632410
Institutional Source Beutler Lab
Gene Symbol Vsig10l
Ensembl Gene ENSMUSG00000070604
Gene NameV-set and immunoglobulin domain containing 10 like
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R8139 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location43463151-43472019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43463729 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 35 (I35T)
Ref Sequence ENSEMBL: ENSMUSP00000144692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107977] [ENSMUST00000203042] [ENSMUST00000203633] [ENSMUST00000203769] [ENSMUST00000204680]
Predicted Effect probably benign
Transcript: ENSMUST00000107977
AA Change: I137T

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103611
Gene: ENSMUSG00000070604
AA Change: I137T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
IG 183 285 1.92e0 SMART
IG 298 383 2.15e-3 SMART
IGc2 406 465 4.19e-6 SMART
Blast:IG_like 582 649 1e-13 BLAST
transmembrane domain 764 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203042
Predicted Effect probably benign
Transcript: ENSMUST00000203633
SMART Domains Protein: ENSMUSP00000145061
Gene: ENSMUSG00000107482

DomainStartEndE-ValueType
ETF 26 216 2.7e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203769
AA Change: I35T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000144692
Gene: ENSMUSG00000070604
AA Change: I35T

DomainStartEndE-ValueType
IG 81 183 8.1e-3 SMART
IG 196 281 9.2e-6 SMART
IGc2 304 363 1.8e-8 SMART
Blast:IG_like 480 547 9e-14 BLAST
transmembrane domain 662 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204680
SMART Domains Protein: ENSMUSP00000145493
Gene: ENSMUSG00000107482

DomainStartEndE-ValueType
ETF 26 168 2.4e-17 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G T X: 70,394,514 Q58K possibly damaging Het
9130409I23Rik A G 1: 181,054,793 D40G probably damaging Het
Aamdc T C 7: 97,565,243 M42V probably benign Het
Abca6 T A 11: 110,184,133 Q1368L probably damaging Het
Best3 G A 10: 117,004,426 G254R probably damaging Het
Cacna1h A T 17: 25,383,723 I1478N probably damaging Het
Ccdc113 T A 8: 95,558,738 M350K possibly damaging Het
Cdc42bpa A T 1: 180,069,319 H389L probably damaging Het
Cnn3 G T 3: 121,455,069 M208I probably damaging Het
Col11a1 A G 3: 114,097,049 D345G unknown Het
Dnah14 G T 1: 181,755,288 V3131F probably damaging Het
Dst T A 1: 34,191,852 M2842K probably benign Het
Dus3l C T 17: 56,767,058 Q211* probably null Het
Eftud2 A G 11: 102,867,859 F171S probably benign Het
Elac2 T C 11: 64,980,614 I117T probably benign Het
Fam13b A G 18: 34,473,633 C302R possibly damaging Het
Fbxl5 G A 5: 43,758,745 Q442* probably null Het
Fhdc1 A G 3: 84,451,483 S370P probably damaging Het
Gm35911 A G 5: 99,924,926 I111V probably benign Het
I830077J02Rik A G 3: 105,927,998 V21A probably benign Het
Inf2 G T 12: 112,601,640 E209* probably null Het
Irs1 A T 1: 82,289,739 M252K probably damaging Het
Kcng3 C A 17: 83,631,087 V178L probably damaging Het
Kif16b A C 2: 142,901,365 S3A probably benign Het
Kit T C 5: 75,652,805 M884T probably damaging Het
Kmt2a A T 9: 44,819,290 probably benign Het
Kptn T C 7: 16,123,976 I243T probably benign Het
Loxhd1 G A 18: 77,380,496 E947K possibly damaging Het
Lyl1 A T 8: 84,702,847 I62L probably damaging Het
Mmp24 C T 2: 155,814,045 R468* probably null Het
Mrvi1 A G 7: 110,899,672 probably null Het
Mtx2 G A 2: 74,876,370 D230N probably benign Het
Ndufa5 A T 6: 24,522,758 Y28* probably null Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Nrxn3 A G 12: 90,204,664 N923S probably benign Het
Ogfod2 C T 5: 124,113,475 T116M possibly damaging Het
Olfr1220 A G 2: 89,097,843 V28A probably benign Het
Olfr492 T A 7: 108,322,906 T257S probably benign Het
Olfr835 A T 9: 19,035,575 I151F probably benign Het
Olfr846 A C 9: 19,361,208 V49G probably damaging Het
Oosp1 T C 19: 11,667,754 E182G possibly damaging Het
Oxnad1 C A 14: 32,092,091 T47K possibly damaging Het
Pcdha5 A G 18: 36,962,738 M767V possibly damaging Het
Pcnx3 A T 19: 5,665,745 H1444Q probably benign Het
Pde4dip G T 3: 97,696,993 Q2224K probably benign Het
Pgr A T 9: 8,956,340 H763L possibly damaging Het
Plec T C 15: 76,174,310 D3809G probably damaging Het
Ppfia1 A G 7: 144,520,693 S155P probably damaging Het
Ppfia4 A G 1: 134,300,528 V1090A probably benign Het
Ptgdr T C 14: 44,858,685 E190G probably benign Het
Rhbdd2 T A 5: 135,636,335 C173* probably null Het
Rhobtb1 C A 10: 69,266,290 P134T probably damaging Het
Slc25a36 A T 9: 97,080,452 F161L probably benign Het
Slc5a11 A G 7: 123,269,976 T596A probably benign Het
Slco1a6 T C 6: 142,089,900 Y566C probably damaging Het
Snx15 T G 19: 6,119,915 K321T probably damaging Het
Snx15 T C 19: 6,119,916 K321E probably damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Syt8 T C 7: 142,438,268 I32T probably benign Het
Thumpd1 T C 7: 119,720,585 N53D possibly damaging Het
Timm21 T C 18: 84,951,138 T54A probably benign Het
Tmed10 A G 12: 85,344,317 V149A probably damaging Het
Tmem108 T A 9: 103,499,885 M122L probably benign Het
Tram1l1 A G 3: 124,321,787 I199V probably benign Het
Tspan8 A G 10: 115,839,897 N156S probably benign Het
Vars T C 17: 35,011,504 V521A probably benign Het
Vmn2r54 G T 7: 12,615,816 T613N possibly damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Vps33a T C 5: 123,533,952 K451R probably benign Het
Xpnpep3 T A 15: 81,448,459 L399Q probably damaging Het
Zfp438 T C 18: 5,214,013 E315G probably benign Het
Zfp467 C T 6: 48,439,334 G128D probably damaging Het
Other mutations in Vsig10l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Vsig10l APN 7 43465254 missense probably damaging 1.00
IGL01390:Vsig10l APN 7 43466465 missense probably damaging 0.97
IGL02401:Vsig10l APN 7 43464044 missense probably damaging 1.00
IGL02404:Vsig10l APN 7 43463747 missense possibly damaging 0.85
IGL02514:Vsig10l APN 7 43463914 missense probably benign 0.02
IGL02636:Vsig10l APN 7 43463578 missense possibly damaging 0.53
IGL02805:Vsig10l APN 7 43465242 missense probably damaging 1.00
IGL02823:Vsig10l APN 7 43466464 missense probably damaging 1.00
IGL02827:Vsig10l APN 7 43464869 missense probably damaging 1.00
R0111:Vsig10l UTSW 7 43468101 missense probably damaging 0.97
R0394:Vsig10l UTSW 7 43465455 missense probably damaging 0.97
R0465:Vsig10l UTSW 7 43467442 missense probably damaging 1.00
R0632:Vsig10l UTSW 7 43464137 missense probably damaging 0.97
R1689:Vsig10l UTSW 7 43465368 missense possibly damaging 0.93
R1991:Vsig10l UTSW 7 43467468 missense possibly damaging 0.89
R2103:Vsig10l UTSW 7 43467468 missense possibly damaging 0.89
R2358:Vsig10l UTSW 7 43468761 missense probably benign 0.00
R3015:Vsig10l UTSW 7 43467457 missense possibly damaging 0.73
R4024:Vsig10l UTSW 7 43468086 missense probably benign 0.33
R4031:Vsig10l UTSW 7 43465374 missense probably damaging 1.00
R4807:Vsig10l UTSW 7 43463749 missense possibly damaging 0.53
R5020:Vsig10l UTSW 7 43465317 nonsense probably null
R5261:Vsig10l UTSW 7 43470850 missense probably damaging 1.00
R5317:Vsig10l UTSW 7 43464823 missense probably damaging 1.00
R5426:Vsig10l UTSW 7 43464823 missense probably damaging 0.97
R5656:Vsig10l UTSW 7 43464151 nonsense probably null
R5842:Vsig10l UTSW 7 43468972 missense probably benign 0.15
R6012:Vsig10l UTSW 7 43468015 missense probably damaging 1.00
R6235:Vsig10l UTSW 7 43468972 missense probably benign 0.15
R6309:Vsig10l UTSW 7 43470973 utr 3 prime probably null
R6994:Vsig10l UTSW 7 43465067 missense possibly damaging 0.71
R7250:Vsig10l UTSW 7 43463675 missense probably benign
R7397:Vsig10l UTSW 7 43468007 missense probably damaging 1.00
R7767:Vsig10l UTSW 7 43463717 missense probably damaging 0.96
R8086:Vsig10l UTSW 7 43465452 missense possibly damaging 0.92
R8297:Vsig10l UTSW 7 43464107 missense possibly damaging 0.50
X0028:Vsig10l UTSW 7 43463364 utr 3 prime probably benign
X0067:Vsig10l UTSW 7 43467490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCCTGGATTATTCAGGAC -3'
(R):5'- AATTAGTGGAGCCTGTGACCC -3'

Sequencing Primer
(F):5'- GCCTGGATTATTCAGGACCAATG -3'
(R):5'- AATACCTTGGAACCCCGGCG -3'
Posted On2020-06-30