Incidental Mutation 'R8139:Mrvi1'
ID632413
Institutional Source Beutler Lab
Gene Symbol Mrvi1
Ensembl Gene ENSMUSG00000005611
Gene NameMRV integration site 1
SynonymsRis1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R8139 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location110868266-110982461 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 110899672 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005751] [ENSMUST00000125758] [ENSMUST00000127935]
Predicted Effect probably null
Transcript: ENSMUST00000005751
SMART Domains Protein: ENSMUSP00000005751
Gene: ENSMUSG00000005611

DomainStartEndE-ValueType
low complexity region 98 113 N/A INTRINSIC
low complexity region 138 160 N/A INTRINSIC
Pfam:MRVI1 265 856 1.8e-227 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000125758
SMART Domains Protein: ENSMUSP00000114578
Gene: ENSMUSG00000005611

DomainStartEndE-ValueType
low complexity region 163 178 N/A INTRINSIC
low complexity region 203 225 N/A INTRINSIC
Pfam:MRVI1 336 921 1.5e-202 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000127935
SMART Domains Protein: ENSMUSP00000120045
Gene: ENSMUSG00000005611

DomainStartEndE-ValueType
Pfam:MRVI1 124 715 7.9e-228 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: This gene is a putative tumor suppressor gene that is frequently disrupted by mouse AIDS-related virus (MRV). The encoded protein participates in signaling by nitric oxide (NO) to inhibit intracellular calcium release and platelet aggregation in cardiovascular tissue. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show lower blood pressure, a slightly reduced heart rate, and failure of cGMP-mediated relaxation of receptor-triggered smooth muscle contraction; 50% of mice die prematurely with an enlarged stomach, a dilated cecum, pyloric stenosis and impaired GI motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G T X: 70,394,514 Q58K possibly damaging Het
9130409I23Rik A G 1: 181,054,793 D40G probably damaging Het
Aamdc T C 7: 97,565,243 M42V probably benign Het
Abca6 T A 11: 110,184,133 Q1368L probably damaging Het
Best3 G A 10: 117,004,426 G254R probably damaging Het
Cacna1h A T 17: 25,383,723 I1478N probably damaging Het
Ccdc113 T A 8: 95,558,738 M350K possibly damaging Het
Cdc42bpa A T 1: 180,069,319 H389L probably damaging Het
Cnn3 G T 3: 121,455,069 M208I probably damaging Het
Col11a1 A G 3: 114,097,049 D345G unknown Het
Dnah14 G T 1: 181,755,288 V3131F probably damaging Het
Dst T A 1: 34,191,852 M2842K probably benign Het
Dus3l C T 17: 56,767,058 Q211* probably null Het
Eftud2 A G 11: 102,867,859 F171S probably benign Het
Elac2 T C 11: 64,980,614 I117T probably benign Het
Fam13b A G 18: 34,473,633 C302R possibly damaging Het
Fbxl5 G A 5: 43,758,745 Q442* probably null Het
Fhdc1 A G 3: 84,451,483 S370P probably damaging Het
Gm35911 A G 5: 99,924,926 I111V probably benign Het
Gtf3c6 T C 10: 40,257,473 probably null Het
I830077J02Rik A G 3: 105,927,998 V21A probably benign Het
Inf2 G T 12: 112,601,640 E209* probably null Het
Irs1 A T 1: 82,289,739 M252K probably damaging Het
Kcng3 C A 17: 83,631,087 V178L probably damaging Het
Kif16b A C 2: 142,901,365 S3A probably benign Het
Kit T C 5: 75,652,805 M884T probably damaging Het
Kmt2a A T 9: 44,819,290 probably benign Het
Kptn T C 7: 16,123,976 I243T probably benign Het
Loxhd1 G A 18: 77,380,496 E947K possibly damaging Het
Lyl1 A T 8: 84,702,847 I62L probably damaging Het
Mmp24 C T 2: 155,814,045 R468* probably null Het
Mtx2 G A 2: 74,876,370 D230N probably benign Het
Ndufa5 A T 6: 24,522,758 Y28* probably null Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Nrxn3 A G 12: 90,204,664 N923S probably benign Het
Ogfod2 C T 5: 124,113,475 T116M possibly damaging Het
Olfr1220 A G 2: 89,097,843 V28A probably benign Het
Olfr492 T A 7: 108,322,906 T257S probably benign Het
Olfr835 A T 9: 19,035,575 I151F probably benign Het
Olfr846 A C 9: 19,361,208 V49G probably damaging Het
Oosp1 T C 19: 11,667,754 E182G possibly damaging Het
Oxnad1 C A 14: 32,092,091 T47K possibly damaging Het
Pcdha5 A G 18: 36,962,738 M767V possibly damaging Het
Pcnx3 A T 19: 5,665,745 H1444Q probably benign Het
Pde4dip G T 3: 97,696,993 Q2224K probably benign Het
Pgr A T 9: 8,956,340 H763L possibly damaging Het
Plec T C 15: 76,174,310 D3809G probably damaging Het
Ppfia1 A G 7: 144,520,693 S155P probably damaging Het
Ppfia4 A G 1: 134,300,528 V1090A probably benign Het
Ptgdr T C 14: 44,858,685 E190G probably benign Het
Rhbdd2 T A 5: 135,636,335 C173* probably null Het
Rhobtb1 C A 10: 69,266,290 P134T probably damaging Het
Slc25a36 A T 9: 97,080,452 F161L probably benign Het
Slc5a11 A G 7: 123,269,976 T596A probably benign Het
Slco1a6 T C 6: 142,089,900 Y566C probably damaging Het
Snx15 T G 19: 6,119,915 K321T probably damaging Het
Snx15 T C 19: 6,119,916 K321E probably damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Syt8 T C 7: 142,438,268 I32T probably benign Het
Thumpd1 T C 7: 119,720,585 N53D possibly damaging Het
Timm21 T C 18: 84,951,138 T54A probably benign Het
Tmed10 A G 12: 85,344,317 V149A probably damaging Het
Tmem108 T A 9: 103,499,885 M122L probably benign Het
Tram1l1 A G 3: 124,321,787 I199V probably benign Het
Tspan8 A G 10: 115,839,897 N156S probably benign Het
Vars T C 17: 35,011,504 V521A probably benign Het
Vmn2r54 G T 7: 12,615,816 T613N possibly damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Vps33a T C 5: 123,533,952 K451R probably benign Het
Vsig10l T C 7: 43,463,729 I35T probably benign Het
Xpnpep3 T A 15: 81,448,459 L399Q probably damaging Het
Zfp438 T C 18: 5,214,013 E315G probably benign Het
Zfp467 C T 6: 48,439,334 G128D probably damaging Het
Other mutations in Mrvi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Mrvi1 APN 7 110945967 missense possibly damaging 0.64
IGL01384:Mrvi1 APN 7 110926501 missense possibly damaging 0.89
IGL01474:Mrvi1 APN 7 110871433 missense possibly damaging 0.65
IGL02081:Mrvi1 APN 7 110924074 critical splice acceptor site probably null
IGL02193:Mrvi1 APN 7 110898955 missense probably damaging 1.00
IGL02537:Mrvi1 APN 7 110871473 nonsense probably null
IGL03084:Mrvi1 APN 7 110885829 splice site probably benign
IGL03264:Mrvi1 APN 7 110926346 missense probably benign 0.00
hurricane UTSW 7 110923963 missense probably benign 0.09
R0346:Mrvi1 UTSW 7 110898976 missense probably damaging 1.00
R0401:Mrvi1 UTSW 7 110876897 missense probably benign 0.09
R0731:Mrvi1 UTSW 7 110876900 missense probably benign 0.00
R1168:Mrvi1 UTSW 7 110895931 missense probably damaging 1.00
R1342:Mrvi1 UTSW 7 110888045 missense probably benign 0.07
R1887:Mrvi1 UTSW 7 110924533 critical splice donor site probably null
R2183:Mrvi1 UTSW 7 110898982 missense probably damaging 1.00
R3417:Mrvi1 UTSW 7 110876954 missense possibly damaging 0.90
R3736:Mrvi1 UTSW 7 110923963 missense probably benign 0.09
R4063:Mrvi1 UTSW 7 110923777 missense probably benign 0.38
R4436:Mrvi1 UTSW 7 110876917 missense probably damaging 1.00
R4523:Mrvi1 UTSW 7 110923841 missense probably benign 0.02
R4948:Mrvi1 UTSW 7 110888029 missense probably damaging 1.00
R5070:Mrvi1 UTSW 7 110925312 missense probably benign
R5085:Mrvi1 UTSW 7 110871493 missense probably damaging 1.00
R5605:Mrvi1 UTSW 7 110946002 missense possibly damaging 0.85
R6194:Mrvi1 UTSW 7 110899694 missense probably damaging 1.00
R6218:Mrvi1 UTSW 7 110876905 missense probably benign 0.00
R6273:Mrvi1 UTSW 7 110871583 missense probably benign 0.01
R6608:Mrvi1 UTSW 7 110888551 missense probably damaging 1.00
R6754:Mrvi1 UTSW 7 110929512 missense probably damaging 1.00
R6835:Mrvi1 UTSW 7 110921334 missense probably damaging 1.00
R7064:Mrvi1 UTSW 7 110895854 missense probably damaging 1.00
R7304:Mrvi1 UTSW 7 110899724 missense possibly damaging 0.77
R7412:Mrvi1 UTSW 7 110923756 missense probably benign 0.06
R7420:Mrvi1 UTSW 7 110871473 nonsense probably null
R7857:Mrvi1 UTSW 7 110923535 nonsense probably null
R8078:Mrvi1 UTSW 7 110899735 missense probably damaging 1.00
R8280:Mrvi1 UTSW 7 110923621 missense possibly damaging 0.82
X0065:Mrvi1 UTSW 7 110924044 missense probably benign 0.31
Z1176:Mrvi1 UTSW 7 110923999 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCATCGCTCTCCTAAGGATCTG -3'
(R):5'- GGCTTGAGCAAGAATCCCAC -3'

Sequencing Primer
(F):5'- TCTCCTAAGGATCTGCCAGG -3'
(R):5'- CGGCAGTCACTCCTTCCAG -3'
Posted On2020-06-30