Incidental Mutation 'R8139:Syt8'
ID632416
Institutional Source Beutler Lab
Gene Symbol Syt8
Ensembl Gene ENSMUSG00000031098
Gene Namesynaptotagmin VIII
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R8139 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location142434850-142440396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142438268 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 32 (I32T)
Ref Sequence ENSEMBL: ENSMUSP00000113545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097939] [ENSMUST00000105971] [ENSMUST00000105973] [ENSMUST00000105976] [ENSMUST00000105977] [ENSMUST00000118276] [ENSMUST00000122393] [ENSMUST00000145287] [ENSMUST00000149529] [ENSMUST00000210239] [ENSMUST00000210746]
Predicted Effect probably benign
Transcript: ENSMUST00000097939
AA Change: I32T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000095552
Gene: ENSMUSG00000031098
AA Change: I32T

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
C2 123 222 1.86e-15 SMART
C2 251 361 8.69e-16 SMART
low complexity region 380 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105971
SMART Domains Protein: ENSMUSP00000101591
Gene: ENSMUSG00000031097

DomainStartEndE-ValueType
Pfam:Troponin 15 145 1.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105973
SMART Domains Protein: ENSMUSP00000101593
Gene: ENSMUSG00000031097

DomainStartEndE-ValueType
Pfam:Troponin 10 153 1.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105976
AA Change: I32T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000101596
Gene: ENSMUSG00000031098
AA Change: I32T

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
C2 123 222 1.86e-15 SMART
C2 251 361 8.69e-16 SMART
low complexity region 380 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105977
AA Change: I32T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000101597
Gene: ENSMUSG00000031098
AA Change: I32T

DomainStartEndE-ValueType
Pfam:UPF0560 14 88 2.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118276
AA Change: I32T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113545
Gene: ENSMUSG00000031098
AA Change: I32T

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
C2 129 228 1.86e-15 SMART
C2 257 367 8.69e-16 SMART
low complexity region 386 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122393
AA Change: I38T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112689
Gene: ENSMUSG00000031098
AA Change: I38T

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
C2 129 228 1.86e-15 SMART
C2 257 367 8.69e-16 SMART
low complexity region 386 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145287
SMART Domains Protein: ENSMUSP00000121819
Gene: ENSMUSG00000031097

DomainStartEndE-ValueType
Pfam:Troponin 15 135 4.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149529
SMART Domains Protein: ENSMUSP00000122733
Gene: ENSMUSG00000031097

DomainStartEndE-ValueType
Pfam:Troponin 15 145 1.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210239
Predicted Effect probably benign
Transcript: ENSMUST00000210746
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptotagmin protein family. Synaptotagmins are membrane proteins that are important in neurotransmission and hormone secretion, both of which involve regulated exocytosis. Expression of the encoded protein in human pancreatic islets has been connected to activity of the promoter for the insulin gene, on the same chromosome several hundred kilobases away (PMID: 21336277 and 22928559). This association would link response to gluclose to insulin secretion. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G T X: 70,394,514 Q58K possibly damaging Het
9130409I23Rik A G 1: 181,054,793 D40G probably damaging Het
Aamdc T C 7: 97,565,243 M42V probably benign Het
Abca6 T A 11: 110,184,133 Q1368L probably damaging Het
Best3 G A 10: 117,004,426 G254R probably damaging Het
Cacna1h A T 17: 25,383,723 I1478N probably damaging Het
Ccdc113 T A 8: 95,558,738 M350K possibly damaging Het
Cdc42bpa A T 1: 180,069,319 H389L probably damaging Het
Cnn3 G T 3: 121,455,069 M208I probably damaging Het
Col11a1 A G 3: 114,097,049 D345G unknown Het
Dnah14 G T 1: 181,755,288 V3131F probably damaging Het
Dst T A 1: 34,191,852 M2842K probably benign Het
Dus3l C T 17: 56,767,058 Q211* probably null Het
Eftud2 A G 11: 102,867,859 F171S probably benign Het
Elac2 T C 11: 64,980,614 I117T probably benign Het
Fam13b A G 18: 34,473,633 C302R possibly damaging Het
Fbxl5 G A 5: 43,758,745 Q442* probably null Het
Fhdc1 A G 3: 84,451,483 S370P probably damaging Het
Gm35911 A G 5: 99,924,926 I111V probably benign Het
Gtf3c6 T C 10: 40,257,473 probably null Het
I830077J02Rik A G 3: 105,927,998 V21A probably benign Het
Inf2 G T 12: 112,601,640 E209* probably null Het
Irs1 A T 1: 82,289,739 M252K probably damaging Het
Kcng3 C A 17: 83,631,087 V178L probably damaging Het
Kif16b A C 2: 142,901,365 S3A probably benign Het
Kit T C 5: 75,652,805 M884T probably damaging Het
Kmt2a A T 9: 44,819,290 probably benign Het
Kptn T C 7: 16,123,976 I243T probably benign Het
Loxhd1 G A 18: 77,380,496 E947K possibly damaging Het
Lyl1 A T 8: 84,702,847 I62L probably damaging Het
Mmp24 C T 2: 155,814,045 R468* probably null Het
Mrvi1 A G 7: 110,899,672 probably null Het
Mtx2 G A 2: 74,876,370 D230N probably benign Het
Ndufa5 A T 6: 24,522,758 Y28* probably null Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Nrxn3 A G 12: 90,204,664 N923S probably benign Het
Ogfod2 C T 5: 124,113,475 T116M possibly damaging Het
Olfr1220 A G 2: 89,097,843 V28A probably benign Het
Olfr492 T A 7: 108,322,906 T257S probably benign Het
Olfr835 A T 9: 19,035,575 I151F probably benign Het
Olfr846 A C 9: 19,361,208 V49G probably damaging Het
Oosp1 T C 19: 11,667,754 E182G possibly damaging Het
Oxnad1 C A 14: 32,092,091 T47K possibly damaging Het
Pcdha5 A G 18: 36,962,738 M767V possibly damaging Het
Pcnx3 A T 19: 5,665,745 H1444Q probably benign Het
Pde4dip G T 3: 97,696,993 Q2224K probably benign Het
Pgr A T 9: 8,956,340 H763L possibly damaging Het
Plec T C 15: 76,174,310 D3809G probably damaging Het
Ppfia1 A G 7: 144,520,693 S155P probably damaging Het
Ppfia4 A G 1: 134,300,528 V1090A probably benign Het
Ptgdr T C 14: 44,858,685 E190G probably benign Het
Rhbdd2 T A 5: 135,636,335 C173* probably null Het
Rhobtb1 C A 10: 69,266,290 P134T probably damaging Het
Slc25a36 A T 9: 97,080,452 F161L probably benign Het
Slc5a11 A G 7: 123,269,976 T596A probably benign Het
Slco1a6 T C 6: 142,089,900 Y566C probably damaging Het
Snx15 T G 19: 6,119,915 K321T probably damaging Het
Snx15 T C 19: 6,119,916 K321E probably damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Thumpd1 T C 7: 119,720,585 N53D possibly damaging Het
Timm21 T C 18: 84,951,138 T54A probably benign Het
Tmed10 A G 12: 85,344,317 V149A probably damaging Het
Tmem108 T A 9: 103,499,885 M122L probably benign Het
Tram1l1 A G 3: 124,321,787 I199V probably benign Het
Tspan8 A G 10: 115,839,897 N156S probably benign Het
Vars T C 17: 35,011,504 V521A probably benign Het
Vmn2r54 G T 7: 12,615,816 T613N possibly damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Vps33a T C 5: 123,533,952 K451R probably benign Het
Vsig10l T C 7: 43,463,729 I35T probably benign Het
Xpnpep3 T A 15: 81,448,459 L399Q probably damaging Het
Zfp438 T C 18: 5,214,013 E315G probably benign Het
Zfp467 C T 6: 48,439,334 G128D probably damaging Het
Other mutations in Syt8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01980:Syt8 APN 7 142440140 missense probably damaging 1.00
R0032:Syt8 UTSW 7 142439189 missense probably benign 0.00
R0032:Syt8 UTSW 7 142439189 missense probably benign 0.00
R1819:Syt8 UTSW 7 142438234 missense possibly damaging 0.81
R4549:Syt8 UTSW 7 142439462 missense probably benign 0.13
R4550:Syt8 UTSW 7 142439462 missense probably benign 0.13
R6964:Syt8 UTSW 7 142439421 missense probably benign 0.00
R8008:Syt8 UTSW 7 142438522 missense probably benign 0.00
R8052:Syt8 UTSW 7 142440144 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTTGCTTAGGGTGGACTCAG -3'
(R):5'- TGGCAATAGCAACAGATGACAC -3'

Sequencing Primer
(F):5'- ACTCAGTACTGGCTGCTGAC -3'
(R):5'- TAGCAACAGATGACACAGAGC -3'
Posted On2020-06-30