Incidental Mutation 'R8139:Ppfia1'
ID632417
Institutional Source Beutler Lab
Gene Symbol Ppfia1
Ensembl Gene ENSMUSG00000037519
Gene Nameprotein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1
SynonymsLiprin-alpha1, liprin, C030014K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R8139 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location144476758-144553729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144520693 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 155 (S155P)
Ref Sequence ENSEMBL: ENSMUSP00000138312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168134] [ENSMUST00000182226] [ENSMUST00000182731]
Predicted Effect probably damaging
Transcript: ENSMUST00000168134
AA Change: S155P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126233
Gene: ENSMUSG00000037519
AA Change: S155P

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
coiled coil region 36 137 N/A INTRINSIC
coiled coil region 250 517 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
coiled coil region 621 667 N/A INTRINSIC
low complexity region 681 703 N/A INTRINSIC
low complexity region 750 760 N/A INTRINSIC
low complexity region 791 799 N/A INTRINSIC
SAM 884 953 5.22e-7 SMART
low complexity region 954 966 N/A INTRINSIC
SAM 999 1066 3.89e-6 SMART
SAM 1087 1159 1.14e-7 SMART
low complexity region 1207 1218 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182226
AA Change: S155P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138312
Gene: ENSMUSG00000037519
AA Change: S155P

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
coiled coil region 36 137 N/A INTRINSIC
coiled coil region 250 389 N/A INTRINSIC
coiled coil region 411 542 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
coiled coil region 646 692 N/A INTRINSIC
low complexity region 706 728 N/A INTRINSIC
low complexity region 775 785 N/A INTRINSIC
low complexity region 816 824 N/A INTRINSIC
SAM 909 978 5.22e-7 SMART
low complexity region 979 991 N/A INTRINSIC
SAM 1024 1091 3.89e-6 SMART
SAM 1112 1184 1.14e-7 SMART
low complexity region 1232 1243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182731
SMART Domains Protein: ENSMUSP00000138238
Gene: ENSMUSG00000037519

DomainStartEndE-ValueType
coiled coil region 32 67 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. This protein binds to the intracellular membrane-distal phosphatase domain of tyrosine phosphatase LAR, and appears to localize LAR to cell focal adhesions. This interaction may regulate the disassembly of focal adhesion and thus help orchestrate cell-matrix interactions. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G T X: 70,394,514 Q58K possibly damaging Het
9130409I23Rik A G 1: 181,054,793 D40G probably damaging Het
Aamdc T C 7: 97,565,243 M42V probably benign Het
Abca6 T A 11: 110,184,133 Q1368L probably damaging Het
Best3 G A 10: 117,004,426 G254R probably damaging Het
Cacna1h A T 17: 25,383,723 I1478N probably damaging Het
Ccdc113 T A 8: 95,558,738 M350K possibly damaging Het
Cdc42bpa A T 1: 180,069,319 H389L probably damaging Het
Cnn3 G T 3: 121,455,069 M208I probably damaging Het
Col11a1 A G 3: 114,097,049 D345G unknown Het
Dnah14 G T 1: 181,755,288 V3131F probably damaging Het
Dst T A 1: 34,191,852 M2842K probably benign Het
Dus3l C T 17: 56,767,058 Q211* probably null Het
Eftud2 A G 11: 102,867,859 F171S probably benign Het
Elac2 T C 11: 64,980,614 I117T probably benign Het
Fam13b A G 18: 34,473,633 C302R possibly damaging Het
Fbxl5 G A 5: 43,758,745 Q442* probably null Het
Fhdc1 A G 3: 84,451,483 S370P probably damaging Het
Gm35911 A G 5: 99,924,926 I111V probably benign Het
I830077J02Rik A G 3: 105,927,998 V21A probably benign Het
Inf2 G T 12: 112,601,640 E209* probably null Het
Irs1 A T 1: 82,289,739 M252K probably damaging Het
Kcng3 C A 17: 83,631,087 V178L probably damaging Het
Kif16b A C 2: 142,901,365 S3A probably benign Het
Kit T C 5: 75,652,805 M884T probably damaging Het
Kmt2a A T 9: 44,819,290 probably benign Het
Kptn T C 7: 16,123,976 I243T probably benign Het
Loxhd1 G A 18: 77,380,496 E947K possibly damaging Het
Lyl1 A T 8: 84,702,847 I62L probably damaging Het
Mmp24 C T 2: 155,814,045 R468* probably null Het
Mrvi1 A G 7: 110,899,672 probably null Het
Mtx2 G A 2: 74,876,370 D230N probably benign Het
Ndufa5 A T 6: 24,522,758 Y28* probably null Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Nrxn3 A G 12: 90,204,664 N923S probably benign Het
Ogfod2 C T 5: 124,113,475 T116M possibly damaging Het
Olfr1220 A G 2: 89,097,843 V28A probably benign Het
Olfr492 T A 7: 108,322,906 T257S probably benign Het
Olfr835 A T 9: 19,035,575 I151F probably benign Het
Olfr846 A C 9: 19,361,208 V49G probably damaging Het
Oosp1 T C 19: 11,667,754 E182G possibly damaging Het
Oxnad1 C A 14: 32,092,091 T47K possibly damaging Het
Pcdha5 A G 18: 36,962,738 M767V possibly damaging Het
Pcnx3 A T 19: 5,665,745 H1444Q probably benign Het
Pde4dip G T 3: 97,696,993 Q2224K probably benign Het
Pgr A T 9: 8,956,340 H763L possibly damaging Het
Plec T C 15: 76,174,310 D3809G probably damaging Het
Ppfia4 A G 1: 134,300,528 V1090A probably benign Het
Ptgdr T C 14: 44,858,685 E190G probably benign Het
Rhbdd2 T A 5: 135,636,335 C173* probably null Het
Rhobtb1 C A 10: 69,266,290 P134T probably damaging Het
Slc25a36 A T 9: 97,080,452 F161L probably benign Het
Slc5a11 A G 7: 123,269,976 T596A probably benign Het
Slco1a6 T C 6: 142,089,900 Y566C probably damaging Het
Snx15 T G 19: 6,119,915 K321T probably damaging Het
Snx15 T C 19: 6,119,916 K321E probably damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Syt8 T C 7: 142,438,268 I32T probably benign Het
Thumpd1 T C 7: 119,720,585 N53D possibly damaging Het
Timm21 T C 18: 84,951,138 T54A probably benign Het
Tmed10 A G 12: 85,344,317 V149A probably damaging Het
Tmem108 T A 9: 103,499,885 M122L probably benign Het
Tram1l1 A G 3: 124,321,787 I199V probably benign Het
Tspan8 A G 10: 115,839,897 N156S probably benign Het
Vars T C 17: 35,011,504 V521A probably benign Het
Vmn2r54 G T 7: 12,615,816 T613N possibly damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Vps33a T C 5: 123,533,952 K451R probably benign Het
Vsig10l T C 7: 43,463,729 I35T probably benign Het
Xpnpep3 T A 15: 81,448,459 L399Q probably damaging Het
Zfp438 T C 18: 5,214,013 E315G probably benign Het
Zfp467 C T 6: 48,439,334 G128D probably damaging Het
Other mutations in Ppfia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Ppfia1 APN 7 144481719 missense probably benign 0.00
IGL01771:Ppfia1 APN 7 144482357 missense probably benign 0.36
IGL02220:Ppfia1 APN 7 144481775 missense probably damaging 1.00
IGL02683:Ppfia1 APN 7 144513358 missense probably damaging 0.99
IGL02752:Ppfia1 APN 7 144519604 missense probably benign
PIT1430001:Ppfia1 UTSW 7 144498336 missense probably damaging 1.00
R0081:Ppfia1 UTSW 7 144504974 missense probably damaging 1.00
R0304:Ppfia1 UTSW 7 144482345 missense probably damaging 1.00
R0359:Ppfia1 UTSW 7 144485192 missense probably damaging 0.97
R1836:Ppfia1 UTSW 7 144519631 missense probably benign 0.19
R1934:Ppfia1 UTSW 7 144505110 missense probably benign 0.12
R2195:Ppfia1 UTSW 7 144516107 missense probably damaging 1.00
R3759:Ppfia1 UTSW 7 144516002 missense probably benign 0.34
R3843:Ppfia1 UTSW 7 144504970 missense probably benign 0.31
R4606:Ppfia1 UTSW 7 144485192 missense probably damaging 0.97
R4820:Ppfia1 UTSW 7 144498369 missense probably benign 0.33
R4898:Ppfia1 UTSW 7 144491576 missense probably damaging 1.00
R5069:Ppfia1 UTSW 7 144514473 nonsense probably null
R5070:Ppfia1 UTSW 7 144514473 nonsense probably null
R5076:Ppfia1 UTSW 7 144506264 missense probably damaging 1.00
R5280:Ppfia1 UTSW 7 144485095 missense possibly damaging 0.84
R5473:Ppfia1 UTSW 7 144491492 missense probably benign 0.17
R5656:Ppfia1 UTSW 7 144519974 critical splice donor site probably null
R5818:Ppfia1 UTSW 7 144520568 intron probably benign
R6104:Ppfia1 UTSW 7 144491574 missense possibly damaging 0.95
R6299:Ppfia1 UTSW 7 144510312 missense probably benign 0.11
R6474:Ppfia1 UTSW 7 144506205 missense possibly damaging 0.89
R6705:Ppfia1 UTSW 7 144519174 missense possibly damaging 0.93
R6734:Ppfia1 UTSW 7 144479053 missense probably damaging 1.00
R7062:Ppfia1 UTSW 7 144552473 missense probably benign
R7451:Ppfia1 UTSW 7 144508210 missense probably benign
R7514:Ppfia1 UTSW 7 144517713 missense probably benign 0.01
R7552:Ppfia1 UTSW 7 144506245 missense probably damaging 1.00
R7633:Ppfia1 UTSW 7 144552436 missense possibly damaging 0.89
R7886:Ppfia1 UTSW 7 144519283 missense probably benign
R8038:Ppfia1 UTSW 7 144514916 missense possibly damaging 0.67
R8266:Ppfia1 UTSW 7 144514494 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AGGCCAGTACCCTCTAACTG -3'
(R):5'- CACTTTTCAAGGGGTCATCAAC -3'

Sequencing Primer
(F):5'- CTGAGAAAAGCTTTACATAGGAGCTC -3'
(R):5'- ACCCATTTTTAATTCAGCCTAGGGG -3'
Posted On2020-06-30