Incidental Mutation 'R8139:Lyl1'
ID632418
Institutional Source Beutler Lab
Gene Symbol Lyl1
Ensembl Gene ENSMUSG00000034041
Gene Namelymphoblastomic leukemia 1
SynonymsLyl-1, bHLHa18
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8139 (G1)
Quality Score188.009
Status Validated
Chromosome8
Chromosomal Location84701457-84704715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84702847 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 62 (I62L)
Ref Sequence ENSEMBL: ENSMUSP00000046010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001974] [ENSMUST00000037165] [ENSMUST00000109764] [ENSMUST00000109767] [ENSMUST00000109768] [ENSMUST00000125370]
Predicted Effect probably benign
Transcript: ENSMUST00000001974
SMART Domains Protein: ENSMUSP00000001974
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 55 499 3.5e-151 PFAM
Pfam:Met_10 141 256 1.3e-8 PFAM
ZnF_C3H1 599 625 3.55e-6 SMART
low complexity region 648 661 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000037165
AA Change: I62L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046010
Gene: ENSMUSG00000034041
AA Change: I62L

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
HLH 155 207 3.97e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109764
SMART Domains Protein: ENSMUSP00000105386
Gene: ENSMUSG00000001911

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1e-28 PFAM
DWA 59 167 1.86e-18 SMART
low complexity region 180 191 N/A INTRINSIC
Pfam:CTF_NFI 205 494 9.8e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109767
SMART Domains Protein: ENSMUSP00000105389
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 55 499 4.9e-149 PFAM
Pfam:Met_10 142 256 3.4e-8 PFAM
ZnF_C3H1 599 625 3.55e-6 SMART
low complexity region 648 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109768
SMART Domains Protein: ENSMUSP00000105390
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 48 492 3.1e-149 PFAM
Pfam:Met_10 135 249 4.4e-8 PFAM
ZnF_C3H1 592 618 3.55e-6 SMART
low complexity region 641 654 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125370
SMART Domains Protein: ENSMUSP00000135510
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
Pfam:TRM 55 470 1.7e-140 PFAM
Pfam:Met_10 142 256 2.8e-8 PFAM
ZnF_C3H1 570 596 3.55e-6 SMART
low complexity region 619 632 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136423
SMART Domains Protein: ENSMUSP00000134723
Gene: ENSMUSG00000001909

DomainStartEndE-ValueType
low complexity region 190 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175884
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a basic helix-loop-helix transcription factor. The encoded protein may play roles in blood vessel maturation and hematopoeisis. A translocation between this locus and the T cell receptor beta locus (GeneID 6957) on chromosome 7 has been associated with acute lymphoblastic leukemia. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice with mutation of this gene are vaible and fertile. Defects in production and differentiation of progenitor cells are observed, along with impaired ability of fetal liver or bone marrow cells in reconstituting B and T lineages after transplant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G T X: 70,394,514 Q58K possibly damaging Het
9130409I23Rik A G 1: 181,054,793 D40G probably damaging Het
Aamdc T C 7: 97,565,243 M42V probably benign Het
Abca6 T A 11: 110,184,133 Q1368L probably damaging Het
Best3 G A 10: 117,004,426 G254R probably damaging Het
Cacna1h A T 17: 25,383,723 I1478N probably damaging Het
Ccdc113 T A 8: 95,558,738 M350K possibly damaging Het
Cdc42bpa A T 1: 180,069,319 H389L probably damaging Het
Cnn3 G T 3: 121,455,069 M208I probably damaging Het
Col11a1 A G 3: 114,097,049 D345G unknown Het
Dnah14 G T 1: 181,755,288 V3131F probably damaging Het
Dst T A 1: 34,191,852 M2842K probably benign Het
Dus3l C T 17: 56,767,058 Q211* probably null Het
Eftud2 A G 11: 102,867,859 F171S probably benign Het
Elac2 T C 11: 64,980,614 I117T probably benign Het
Fam13b A G 18: 34,473,633 C302R possibly damaging Het
Fbxl5 G A 5: 43,758,745 Q442* probably null Het
Fhdc1 A G 3: 84,451,483 S370P probably damaging Het
Gm35911 A G 5: 99,924,926 I111V probably benign Het
Gtf3c6 T C 10: 40,257,473 probably null Het
I830077J02Rik A G 3: 105,927,998 V21A probably benign Het
Inf2 G T 12: 112,601,640 E209* probably null Het
Irs1 A T 1: 82,289,739 M252K probably damaging Het
Kcng3 C A 17: 83,631,087 V178L probably damaging Het
Kif16b A C 2: 142,901,365 S3A probably benign Het
Kit T C 5: 75,652,805 M884T probably damaging Het
Kmt2a A T 9: 44,819,290 probably benign Het
Kptn T C 7: 16,123,976 I243T probably benign Het
Loxhd1 G A 18: 77,380,496 E947K possibly damaging Het
Mmp24 C T 2: 155,814,045 R468* probably null Het
Mrvi1 A G 7: 110,899,672 probably null Het
Mtx2 G A 2: 74,876,370 D230N probably benign Het
Ndufa5 A T 6: 24,522,758 Y28* probably null Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Nrxn3 A G 12: 90,204,664 N923S probably benign Het
Ogfod2 C T 5: 124,113,475 T116M possibly damaging Het
Olfr1220 A G 2: 89,097,843 V28A probably benign Het
Olfr492 T A 7: 108,322,906 T257S probably benign Het
Olfr835 A T 9: 19,035,575 I151F probably benign Het
Olfr846 A C 9: 19,361,208 V49G probably damaging Het
Oosp1 T C 19: 11,667,754 E182G possibly damaging Het
Oxnad1 C A 14: 32,092,091 T47K possibly damaging Het
Pcdha5 A G 18: 36,962,738 M767V possibly damaging Het
Pcnx3 A T 19: 5,665,745 H1444Q probably benign Het
Pde4dip G T 3: 97,696,993 Q2224K probably benign Het
Pgr A T 9: 8,956,340 H763L possibly damaging Het
Plec T C 15: 76,174,310 D3809G probably damaging Het
Ppfia1 A G 7: 144,520,693 S155P probably damaging Het
Ppfia4 A G 1: 134,300,528 V1090A probably benign Het
Ptgdr T C 14: 44,858,685 E190G probably benign Het
Rhbdd2 T A 5: 135,636,335 C173* probably null Het
Rhobtb1 C A 10: 69,266,290 P134T probably damaging Het
Slc25a36 A T 9: 97,080,452 F161L probably benign Het
Slc5a11 A G 7: 123,269,976 T596A probably benign Het
Slco1a6 T C 6: 142,089,900 Y566C probably damaging Het
Snx15 T G 19: 6,119,915 K321T probably damaging Het
Snx15 T C 19: 6,119,916 K321E probably damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Syt8 T C 7: 142,438,268 I32T probably benign Het
Thumpd1 T C 7: 119,720,585 N53D possibly damaging Het
Timm21 T C 18: 84,951,138 T54A probably benign Het
Tmed10 A G 12: 85,344,317 V149A probably damaging Het
Tmem108 T A 9: 103,499,885 M122L probably benign Het
Tram1l1 A G 3: 124,321,787 I199V probably benign Het
Tspan8 A G 10: 115,839,897 N156S probably benign Het
Vars T C 17: 35,011,504 V521A probably benign Het
Vmn2r54 G T 7: 12,615,816 T613N possibly damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Vps33a T C 5: 123,533,952 K451R probably benign Het
Vsig10l T C 7: 43,463,729 I35T probably benign Het
Xpnpep3 T A 15: 81,448,459 L399Q probably damaging Het
Zfp438 T C 18: 5,214,013 E315G probably benign Het
Zfp467 C T 6: 48,439,334 G128D probably damaging Het
Other mutations in Lyl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Lyl1 APN 8 84702686 missense possibly damaging 0.46
IGL02948:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL02976:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03037:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03038:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03061:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03106:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03115:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03146:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03152:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03166:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03175:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03221:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03226:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03296:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03346:Lyl1 APN 8 84702671 missense possibly damaging 0.52
IGL03014:Lyl1 UTSW 8 84702671 missense possibly damaging 0.52
IGL03050:Lyl1 UTSW 8 84702671 missense possibly damaging 0.52
IGL03134:Lyl1 UTSW 8 84702671 missense possibly damaging 0.52
R3944:Lyl1 UTSW 8 84704002 missense probably damaging 1.00
R4752:Lyl1 UTSW 8 84704281 missense probably benign 0.17
R7508:Lyl1 UTSW 8 84704300 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACTCTCTCCCACAGGTTAGC -3'
(R):5'- CCTAAGCACTGCCCATAGTC -3'

Sequencing Primer
(F):5'- CACAGGTTAGCATTCTATCCGTGG -3'
(R):5'- ACTGCCCATAGTCCGAGCTG -3'
Posted On2020-06-30