Incidental Mutation 'R8139:Slc25a36'
ID632424
Institutional Source Beutler Lab
Gene Symbol Slc25a36
Ensembl Gene ENSMUSG00000032449
Gene Namesolute carrier family 25, member 36
SynonymsC330005L02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R8139 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location97074961-97111157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97080452 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 161 (F161L)
Ref Sequence ENSEMBL: ENSMUSP00000082302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035024] [ENSMUST00000085206] [ENSMUST00000153070]
Predicted Effect probably benign
Transcript: ENSMUST00000035024
AA Change: F22L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035024
Gene: ENSMUSG00000032449
AA Change: F22L

DomainStartEndE-ValueType
Pfam:Mito_carr 4 69 1.1e-12 PFAM
Pfam:Mito_carr 83 172 2.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085206
AA Change: F161L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082302
Gene: ENSMUSG00000032449
AA Change: F161L

DomainStartEndE-ValueType
Pfam:Mito_carr 2 113 9.5e-27 PFAM
Pfam:Mito_carr 114 207 2.5e-23 PFAM
Pfam:Mito_carr 222 311 6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153070
SMART Domains Protein: ENSMUSP00000116813
Gene: ENSMUSG00000032449

DomainStartEndE-ValueType
Pfam:Mito_carr 2 113 5.8e-29 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency 100% (84/84)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G T X: 70,394,514 Q58K possibly damaging Het
9130409I23Rik A G 1: 181,054,793 D40G probably damaging Het
Aamdc T C 7: 97,565,243 M42V probably benign Het
Abca6 T A 11: 110,184,133 Q1368L probably damaging Het
Best3 G A 10: 117,004,426 G254R probably damaging Het
Cacna1h A T 17: 25,383,723 I1478N probably damaging Het
Ccdc113 T A 8: 95,558,738 M350K possibly damaging Het
Cdc42bpa A T 1: 180,069,319 H389L probably damaging Het
Cnn3 G T 3: 121,455,069 M208I probably damaging Het
Col11a1 A G 3: 114,097,049 D345G unknown Het
Dnah14 G T 1: 181,755,288 V3131F probably damaging Het
Dst T A 1: 34,191,852 M2842K probably benign Het
Dus3l C T 17: 56,767,058 Q211* probably null Het
Eftud2 A G 11: 102,867,859 F171S probably benign Het
Elac2 T C 11: 64,980,614 I117T probably benign Het
Fam13b A G 18: 34,473,633 C302R possibly damaging Het
Fbxl5 G A 5: 43,758,745 Q442* probably null Het
Fhdc1 A G 3: 84,451,483 S370P probably damaging Het
Gm35911 A G 5: 99,924,926 I111V probably benign Het
Gtf3c6 T C 10: 40,257,473 probably null Het
I830077J02Rik A G 3: 105,927,998 V21A probably benign Het
Inf2 G T 12: 112,601,640 E209* probably null Het
Irs1 A T 1: 82,289,739 M252K probably damaging Het
Kcng3 C A 17: 83,631,087 V178L probably damaging Het
Kif16b A C 2: 142,901,365 S3A probably benign Het
Kit T C 5: 75,652,805 M884T probably damaging Het
Kmt2a A T 9: 44,819,290 probably benign Het
Kptn T C 7: 16,123,976 I243T probably benign Het
Loxhd1 G A 18: 77,380,496 E947K possibly damaging Het
Lyl1 A T 8: 84,702,847 I62L probably damaging Het
Mmp24 C T 2: 155,814,045 R468* probably null Het
Mrvi1 A G 7: 110,899,672 probably null Het
Mtx2 G A 2: 74,876,370 D230N probably benign Het
Ndufa5 A T 6: 24,522,758 Y28* probably null Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Nrxn3 A G 12: 90,204,664 N923S probably benign Het
Ogfod2 C T 5: 124,113,475 T116M possibly damaging Het
Olfr1220 A G 2: 89,097,843 V28A probably benign Het
Olfr492 T A 7: 108,322,906 T257S probably benign Het
Olfr835 A T 9: 19,035,575 I151F probably benign Het
Olfr846 A C 9: 19,361,208 V49G probably damaging Het
Oosp1 T C 19: 11,667,754 E182G possibly damaging Het
Oxnad1 C A 14: 32,092,091 T47K possibly damaging Het
Pcdha5 A G 18: 36,962,738 M767V possibly damaging Het
Pcnx3 A T 19: 5,665,745 H1444Q probably benign Het
Pde4dip G T 3: 97,696,993 Q2224K probably benign Het
Pgr A T 9: 8,956,340 H763L possibly damaging Het
Plec T C 15: 76,174,310 D3809G probably damaging Het
Ppfia1 A G 7: 144,520,693 S155P probably damaging Het
Ppfia4 A G 1: 134,300,528 V1090A probably benign Het
Ptgdr T C 14: 44,858,685 E190G probably benign Het
Rhbdd2 T A 5: 135,636,335 C173* probably null Het
Rhobtb1 C A 10: 69,266,290 P134T probably damaging Het
Slc5a11 A G 7: 123,269,976 T596A probably benign Het
Slco1a6 T C 6: 142,089,900 Y566C probably damaging Het
Snx15 T G 19: 6,119,915 K321T probably damaging Het
Snx15 T C 19: 6,119,916 K321E probably damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Syt8 T C 7: 142,438,268 I32T probably benign Het
Thumpd1 T C 7: 119,720,585 N53D possibly damaging Het
Timm21 T C 18: 84,951,138 T54A probably benign Het
Tmed10 A G 12: 85,344,317 V149A probably damaging Het
Tmem108 T A 9: 103,499,885 M122L probably benign Het
Tram1l1 A G 3: 124,321,787 I199V probably benign Het
Tspan8 A G 10: 115,839,897 N156S probably benign Het
Vars T C 17: 35,011,504 V521A probably benign Het
Vmn2r54 G T 7: 12,615,816 T613N possibly damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Vps33a T C 5: 123,533,952 K451R probably benign Het
Vsig10l T C 7: 43,463,729 I35T probably benign Het
Xpnpep3 T A 15: 81,448,459 L399Q probably damaging Het
Zfp438 T C 18: 5,214,013 E315G probably benign Het
Zfp467 C T 6: 48,439,334 G128D probably damaging Het
Other mutations in Slc25a36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01552:Slc25a36 APN 9 97079233 missense probably benign 0.01
IGL01634:Slc25a36 APN 9 97080481 missense probably benign 0.00
IGL02149:Slc25a36 APN 9 97093069 splice site probably benign
R0394:Slc25a36 UTSW 9 97080204 missense probably benign 0.36
R0518:Slc25a36 UTSW 9 97097175 missense probably damaging 1.00
R1024:Slc25a36 UTSW 9 97079201 missense probably damaging 1.00
R1208:Slc25a36 UTSW 9 97085135 splice site probably benign
R1439:Slc25a36 UTSW 9 97093073 splice site probably benign
R1466:Slc25a36 UTSW 9 97080355 missense probably damaging 1.00
R1466:Slc25a36 UTSW 9 97080355 missense probably damaging 1.00
R1920:Slc25a36 UTSW 9 97093082 missense probably benign 0.00
R2247:Slc25a36 UTSW 9 97100138 missense probably damaging 1.00
R2317:Slc25a36 UTSW 9 97079182 missense probably damaging 1.00
R2518:Slc25a36 UTSW 9 97079071 missense possibly damaging 0.95
R3756:Slc25a36 UTSW 9 97100155 nonsense probably null
R4405:Slc25a36 UTSW 9 97085118 missense probably benign 0.00
R4624:Slc25a36 UTSW 9 97079125 missense probably damaging 0.99
R4719:Slc25a36 UTSW 9 97090119 utr 3 prime probably benign
R5492:Slc25a36 UTSW 9 97100206 missense probably damaging 1.00
R6152:Slc25a36 UTSW 9 97100157 missense probably damaging 1.00
R7823:Slc25a36 UTSW 9 97084391 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TACGCTATGGTTGTGGCACAG -3'
(R):5'- ACATTTGAGCATGGCATGGAG -3'

Sequencing Primer
(F):5'- AAATCCGATGCTTCTTTCACAGAC -3'
(R):5'- CTTCCAGTACTTAATGCCAGT -3'
Posted On2020-06-30