Incidental Mutation 'R8139:Rhobtb1'
ID632426
Institutional Source Beutler Lab
Gene Symbol Rhobtb1
Ensembl Gene ENSMUSG00000019944
Gene NameRho-related BTB domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.550) question?
Stock #R8139 (G1)
Quality Score173.009
Status Validated
Chromosome10
Chromosomal Location69151434-69291791 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 69266290 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 134 (P134T)
Ref Sequence ENSEMBL: ENSMUSP00000020101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020101] [ENSMUST00000067908] [ENSMUST00000163497] [ENSMUST00000164034] [ENSMUST00000167384] [ENSMUST00000168117]
Predicted Effect probably damaging
Transcript: ENSMUST00000020101
AA Change: P134T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020101
Gene: ENSMUSG00000019944
AA Change: P134T

DomainStartEndE-ValueType
RHO 17 210 5.8e-34 SMART
low complexity region 225 246 N/A INTRINSIC
BTB 266 456 6.29e-13 SMART
BTB 484 582 9.03e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000067908
AA Change: P134T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065095
Gene: ENSMUSG00000019944
AA Change: P134T

DomainStartEndE-ValueType
RHO 17 210 5.8e-34 SMART
low complexity region 225 246 N/A INTRINSIC
BTB 266 456 6.29e-13 SMART
BTB 484 582 9.03e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163497
SMART Domains Protein: ENSMUSP00000129119
Gene: ENSMUSG00000019944

DomainStartEndE-ValueType
Pfam:Ras 16 96 1.8e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164034
AA Change: P134T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132068
Gene: ENSMUSG00000019944
AA Change: P134T

DomainStartEndE-ValueType
RHO 17 210 5.8e-34 SMART
low complexity region 225 246 N/A INTRINSIC
BTB 266 456 6.29e-13 SMART
BTB 484 582 9.03e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167384
SMART Domains Protein: ENSMUSP00000131222
Gene: ENSMUSG00000019944

DomainStartEndE-ValueType
PDB:3RYT|C 10 97 8e-6 PDB
SCOP:d1ky3a_ 15 150 8e-16 SMART
Blast:RHO 17 99 5e-50 BLAST
low complexity region 163 184 N/A INTRINSIC
BTB 204 394 6.29e-13 SMART
BTB 422 520 9.03e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168117
SMART Domains Protein: ENSMUSP00000131509
Gene: ENSMUSG00000019944

DomainStartEndE-ValueType
Pfam:Ras 16 97 1.9e-6 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Rho family of the small GTPase superfamily. It contains a GTPase domain, a proline-rich region, a tandem of 2 BTB (broad complex, tramtrack, and bric-a-brac) domains, and a conserved C-terminal region. The protein plays a role in small GTPase-mediated signal transduction and the organization of the actin filament system. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G T X: 70,394,514 Q58K possibly damaging Het
9130409I23Rik A G 1: 181,054,793 D40G probably damaging Het
Aamdc T C 7: 97,565,243 M42V probably benign Het
Abca6 T A 11: 110,184,133 Q1368L probably damaging Het
Best3 G A 10: 117,004,426 G254R probably damaging Het
Cacna1h A T 17: 25,383,723 I1478N probably damaging Het
Ccdc113 T A 8: 95,558,738 M350K possibly damaging Het
Cdc42bpa A T 1: 180,069,319 H389L probably damaging Het
Cnn3 G T 3: 121,455,069 M208I probably damaging Het
Col11a1 A G 3: 114,097,049 D345G unknown Het
Dnah14 G T 1: 181,755,288 V3131F probably damaging Het
Dst T A 1: 34,191,852 M2842K probably benign Het
Dus3l C T 17: 56,767,058 Q211* probably null Het
Eftud2 A G 11: 102,867,859 F171S probably benign Het
Elac2 T C 11: 64,980,614 I117T probably benign Het
Fam13b A G 18: 34,473,633 C302R possibly damaging Het
Fbxl5 G A 5: 43,758,745 Q442* probably null Het
Fhdc1 A G 3: 84,451,483 S370P probably damaging Het
Gm35911 A G 5: 99,924,926 I111V probably benign Het
Gtf3c6 T C 10: 40,257,473 probably null Het
I830077J02Rik A G 3: 105,927,998 V21A probably benign Het
Inf2 G T 12: 112,601,640 E209* probably null Het
Irs1 A T 1: 82,289,739 M252K probably damaging Het
Kcng3 C A 17: 83,631,087 V178L probably damaging Het
Kif16b A C 2: 142,901,365 S3A probably benign Het
Kit T C 5: 75,652,805 M884T probably damaging Het
Kmt2a A T 9: 44,819,290 probably benign Het
Kptn T C 7: 16,123,976 I243T probably benign Het
Loxhd1 G A 18: 77,380,496 E947K possibly damaging Het
Lyl1 A T 8: 84,702,847 I62L probably damaging Het
Mmp24 C T 2: 155,814,045 R468* probably null Het
Mrvi1 A G 7: 110,899,672 probably null Het
Mtx2 G A 2: 74,876,370 D230N probably benign Het
Ndufa5 A T 6: 24,522,758 Y28* probably null Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Nrxn3 A G 12: 90,204,664 N923S probably benign Het
Ogfod2 C T 5: 124,113,475 T116M possibly damaging Het
Olfr1220 A G 2: 89,097,843 V28A probably benign Het
Olfr492 T A 7: 108,322,906 T257S probably benign Het
Olfr835 A T 9: 19,035,575 I151F probably benign Het
Olfr846 A C 9: 19,361,208 V49G probably damaging Het
Oosp1 T C 19: 11,667,754 E182G possibly damaging Het
Oxnad1 C A 14: 32,092,091 T47K possibly damaging Het
Pcdha5 A G 18: 36,962,738 M767V possibly damaging Het
Pcnx3 A T 19: 5,665,745 H1444Q probably benign Het
Pde4dip G T 3: 97,696,993 Q2224K probably benign Het
Pgr A T 9: 8,956,340 H763L possibly damaging Het
Plec T C 15: 76,174,310 D3809G probably damaging Het
Ppfia1 A G 7: 144,520,693 S155P probably damaging Het
Ppfia4 A G 1: 134,300,528 V1090A probably benign Het
Ptgdr T C 14: 44,858,685 E190G probably benign Het
Rhbdd2 T A 5: 135,636,335 C173* probably null Het
Slc25a36 A T 9: 97,080,452 F161L probably benign Het
Slc5a11 A G 7: 123,269,976 T596A probably benign Het
Slco1a6 T C 6: 142,089,900 Y566C probably damaging Het
Snx15 T G 19: 6,119,915 K321T probably damaging Het
Snx15 T C 19: 6,119,916 K321E probably damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Syt8 T C 7: 142,438,268 I32T probably benign Het
Thumpd1 T C 7: 119,720,585 N53D possibly damaging Het
Timm21 T C 18: 84,951,138 T54A probably benign Het
Tmed10 A G 12: 85,344,317 V149A probably damaging Het
Tmem108 T A 9: 103,499,885 M122L probably benign Het
Tram1l1 A G 3: 124,321,787 I199V probably benign Het
Tspan8 A G 10: 115,839,897 N156S probably benign Het
Vars T C 17: 35,011,504 V521A probably benign Het
Vmn2r54 G T 7: 12,615,816 T613N possibly damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Vps33a T C 5: 123,533,952 K451R probably benign Het
Vsig10l T C 7: 43,463,729 I35T probably benign Het
Xpnpep3 T A 15: 81,448,459 L399Q probably damaging Het
Zfp438 T C 18: 5,214,013 E315G probably benign Het
Zfp467 C T 6: 48,439,334 G128D probably damaging Het
Other mutations in Rhobtb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Rhobtb1 APN 10 69270221 missense probably damaging 1.00
IGL01504:Rhobtb1 APN 10 69249698 missense probably damaging 1.00
IGL01561:Rhobtb1 APN 10 69270391 missense probably benign 0.17
IGL01924:Rhobtb1 APN 10 69270304 missense probably damaging 1.00
IGL02252:Rhobtb1 APN 10 69249685 missense probably damaging 1.00
IGL02334:Rhobtb1 APN 10 69285678 splice site probably benign
IGL02393:Rhobtb1 APN 10 69288987 missense probably damaging 1.00
IGL02514:Rhobtb1 APN 10 69289641 missense probably benign 0.00
IGL03192:Rhobtb1 APN 10 69248823 missense probably damaging 1.00
R1687:Rhobtb1 UTSW 10 69270279 missense probably damaging 1.00
R1713:Rhobtb1 UTSW 10 69272771 missense probably benign 0.05
R1713:Rhobtb1 UTSW 10 69272772 missense possibly damaging 0.61
R1750:Rhobtb1 UTSW 10 69279406 missense probably damaging 1.00
R2044:Rhobtb1 UTSW 10 69272863 splice site probably benign
R2312:Rhobtb1 UTSW 10 69270463 nonsense probably null
R2402:Rhobtb1 UTSW 10 69270424 missense probably benign 0.00
R3815:Rhobtb1 UTSW 10 69285693 missense possibly damaging 0.75
R4633:Rhobtb1 UTSW 10 69249613 splice site probably null
R4737:Rhobtb1 UTSW 10 69279497 critical splice donor site probably null
R4780:Rhobtb1 UTSW 10 69270153 missense probably benign 0.02
R4865:Rhobtb1 UTSW 10 69270724 missense probably benign 0.04
R5124:Rhobtb1 UTSW 10 69269901 critical splice acceptor site probably null
R5248:Rhobtb1 UTSW 10 69248785 missense probably damaging 1.00
R5304:Rhobtb1 UTSW 10 69269912 missense probably damaging 1.00
R5480:Rhobtb1 UTSW 10 69270733 missense possibly damaging 0.86
R5836:Rhobtb1 UTSW 10 69269989 missense probably damaging 1.00
R5951:Rhobtb1 UTSW 10 69270255 missense probably damaging 0.99
R6218:Rhobtb1 UTSW 10 69270456 missense probably benign 0.00
R6629:Rhobtb1 UTSW 10 69270316 missense possibly damaging 0.92
R6869:Rhobtb1 UTSW 10 69270226 missense probably damaging 0.99
R7081:Rhobtb1 UTSW 10 69266297 missense probably benign 0.29
R7260:Rhobtb1 UTSW 10 69270780 nonsense probably null
R7427:Rhobtb1 UTSW 10 69248824 missense probably damaging 1.00
R7428:Rhobtb1 UTSW 10 69248824 missense probably damaging 1.00
R8054:Rhobtb1 UTSW 10 69248890 missense probably damaging 1.00
R8144:Rhobtb1 UTSW 10 69289558 missense possibly damaging 0.89
Z1176:Rhobtb1 UTSW 10 69289551 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTTTAATATCCAGCCCTG -3'
(R):5'- TCATAGGTGTAGCCTCCTCG -3'

Sequencing Primer
(F):5'- TGACATGACAGACTTAAATAAGTGG -3'
(R):5'- CTCCTCGGTGGCCAATGAAAAAG -3'
Posted On2020-06-30