Mutagenetix > Incidental Mutations

Incidental Mutation 'R8139:Notch4'

632442

Institutional Source

Beutler Lab

Gene Symbol

Notch4

Ensembl Gene

ENSMUSG00000015468

Gene Name

notch 4

Synonyms

Int3, N4, Int-3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8139 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34564268-34588503 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 34584800 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 1515 (E1515*)

Ref Sequence

ENSEMBL: ENSMUSP00000015612 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015612] [ENSMUST00000173389]

Predicted Effect

probably null
Transcript: ENSMUST00000015612
AA Change: E1515*

SMART Domains

Protein: ENSMUSP00000015612
Gene: ENSMUSG00000015468
AA Change: E1515*

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	24	60	3.2e-4	SMART
EGF	64	112	1.07e-5	SMART
EGF	118	152	5.49e-3	SMART
EGF	156	189	9.33e-6	SMART
EGF_CA	191	229	1.42e-10	SMART
EGF	234	271	1.11e-3	SMART
EGF	276	309	1.84e-4	SMART
EGF_CA	311	350	2.52e-11	SMART
EGF_CA	352	388	1.85e-9	SMART
EGF	392	427	1.58e-3	SMART
EGF_CA	429	470	2.46e-14	SMART
EGF_CA	472	508	5.03e-11	SMART
EGF_CA	510	546	6.74e-12	SMART
EGF_CA	548	584	2.98e-13	SMART
EGF_CA	586	622	7.63e-11	SMART
EGF_like	645	686	2.86e1	SMART
EGF	691	724	3.48e-5	SMART
EGF	729	762	3.62e-3	SMART
EGF_CA	764	800	1.48e-8	SMART
EGF	806	839	1.74e-5	SMART
EGF	844	877	2.3e-5	SMART
EGF	881	924	3.59e-7	SMART
EGF_CA	926	962	7.29e-8	SMART
EGF_CA	965	1000	4.42e-7	SMART
EGF_CA	1002	1040	4.56e-9	SMART
EGF	1045	1081	6.16e-6	SMART
EGF	1086	1122	8.65e-1	SMART
EGF	1129	1167	1.45e-2	SMART
NL	1159	1200	6.79e-13	SMART
NL	1203	1242	2.01e-15	SMART
NL	1243	1281	1.85e-14	SMART
NOD	1287	1341	4.37e-8	SMART
NODP	1373	1437	2.12e-6	SMART
transmembrane domain	1441	1463	N/A	INTRINSIC
low complexity region	1525	1539	N/A	INTRINSIC
ANK	1578	1623	2.5e3	SMART
ANK	1628	1657	1.12e-3	SMART
ANK	1661	1691	5.01e-1	SMART
ANK	1695	1724	1.65e-1	SMART
ANK	1728	1757	4.56e-4	SMART
ANK	1761	1790	2.88e-1	SMART
low complexity region	1889	1906	N/A	INTRINSIC
low complexity region	1925	1937	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000151654

Predicted Effect

probably benign
Transcript: ENSMUST00000151867

Predicted Effect

probably benign
Transcript: ENSMUST00000173389

SMART Domains

Protein: ENSMUSP00000133574
Gene: ENSMUSG00000015468

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	28	64	3.2e-4	SMART
EGF	68	116	1.07e-5	SMART
EGF	122	156	5.49e-3	SMART
EGF	160	193	9.33e-6	SMART
EGF_CA	195	233	1.42e-10	SMART
EGF	238	275	1.11e-3	SMART
EGF	280	313	1.84e-4	SMART
EGF_CA	315	354	2.52e-11	SMART
EGF_CA	356	392	1.85e-9	SMART
EGF	396	431	1.58e-3	SMART
EGF_CA	433	474	2.46e-14	SMART
EGF_CA	476	512	5.03e-11	SMART
EGF_CA	514	550	6.74e-12	SMART
EGF_CA	552	588	2.98e-13	SMART
EGF_CA	590	626	7.63e-11	SMART
EGF_like	649	690	2.86e1	SMART
EGF	695	728	3.48e-5	SMART
EGF	733	766	3.62e-3	SMART
EGF_CA	768	804	1.48e-8	SMART
EGF	810	843	1.74e-5	SMART
EGF	848	881	2.3e-5	SMART
EGF	885	928	3.59e-7	SMART
EGF_like	930	955	7.02e-1	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 94.2%

Validation Efficiency

100% (84/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor may play a role in vascular, renal and hepatic development. Mutations in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile but exhibit a slight delay in postnatal retinal angiogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	G	T	X: 70,394,514	Q58K	possibly damaging	Het
9130409I23Rik	A	G	1: 181,054,793	D40G	probably damaging	Het
Aamdc	T	C	7: 97,565,243	M42V	probably benign	Het
Abca6	T	A	11: 110,184,133	Q1368L	probably damaging	Het
Best3	G	A	10: 117,004,426	G254R	probably damaging	Het
Cacna1h	A	T	17: 25,383,723	I1478N	probably damaging	Het
Ccdc113	T	A	8: 95,558,738	M350K	possibly damaging	Het
Cdc42bpa	A	T	1: 180,069,319	H389L	probably damaging	Het
Cnn3	G	T	3: 121,455,069	M208I	probably damaging	Het
Col11a1	A	G	3: 114,097,049	D345G	unknown	Het
Dnah14	G	T	1: 181,755,288	V3131F	probably damaging	Het
Dst	T	A	1: 34,191,852	M2842K	probably benign	Het
Dus3l	C	T	17: 56,767,058	Q211*	probably null	Het
Eftud2	A	G	11: 102,867,859	F171S	probably benign	Het
Elac2	T	C	11: 64,980,614	I117T	probably benign	Het
Fam13b	A	G	18: 34,473,633	C302R	possibly damaging	Het
Fbxl5	G	A	5: 43,758,745	Q442*	probably null	Het
Fhdc1	A	G	3: 84,451,483	S370P	probably damaging	Het
Gm35911	A	G	5: 99,924,926	I111V	probably benign	Het
Gtf3c6	T	C	10: 40,257,473		probably null	Het
I830077J02Rik	A	G	3: 105,927,998	V21A	probably benign	Het
Inf2	G	T	12: 112,601,640	E209*	probably null	Het
Irs1	A	T	1: 82,289,739	M252K	probably damaging	Het
Kcng3	C	A	17: 83,631,087	V178L	probably damaging	Het
Kif16b	A	C	2: 142,901,365	S3A	probably benign	Het
Kit	T	C	5: 75,652,805	M884T	probably damaging	Het
Kmt2a	A	T	9: 44,819,290		probably benign	Het
Kptn	T	C	7: 16,123,976	I243T	probably benign	Het
Loxhd1	G	A	18: 77,380,496	E947K	possibly damaging	Het
Lyl1	A	T	8: 84,702,847	I62L	probably damaging	Het
Mmp24	C	T	2: 155,814,045	R468*	probably null	Het
Mrvi1	A	G	7: 110,899,672		probably null	Het
Mtx2	G	A	2: 74,876,370	D230N	probably benign	Het
Ndufa5	A	T	6: 24,522,758	Y28*	probably null	Het
Nrxn3	A	G	12: 90,204,664	N923S	probably benign	Het
Ogfod2	C	T	5: 124,113,475	T116M	possibly damaging	Het
Olfr1220	A	G	2: 89,097,843	V28A	probably benign	Het
Olfr492	T	A	7: 108,322,906	T257S	probably benign	Het
Olfr835	A	T	9: 19,035,575	I151F	probably benign	Het
Olfr846	A	C	9: 19,361,208	V49G	probably damaging	Het
Oosp1	T	C	19: 11,667,754	E182G	possibly damaging	Het
Oxnad1	C	A	14: 32,092,091	T47K	possibly damaging	Het
Pcdha5	A	G	18: 36,962,738	M767V	possibly damaging	Het
Pcnx3	A	T	19: 5,665,745	H1444Q	probably benign	Het
Pde4dip	G	T	3: 97,696,993	Q2224K	probably benign	Het
Pgr	A	T	9: 8,956,340	H763L	possibly damaging	Het
Plec	T	C	15: 76,174,310	D3809G	probably damaging	Het
Ppfia1	A	G	7: 144,520,693	S155P	probably damaging	Het
Ppfia4	A	G	1: 134,300,528	V1090A	probably benign	Het
Ptgdr	T	C	14: 44,858,685	E190G	probably benign	Het
Rhbdd2	T	A	5: 135,636,335	C173*	probably null	Het
Rhobtb1	C	A	10: 69,266,290	P134T	probably damaging	Het
Slc25a36	A	T	9: 97,080,452	F161L	probably benign	Het
Slc5a11	A	G	7: 123,269,976	T596A	probably benign	Het
Slco1a6	T	C	6: 142,089,900	Y566C	probably damaging	Het
Snx15	T	G	19: 6,119,915	K321T	probably damaging	Het
Snx15	T	C	19: 6,119,916	K321E	probably damaging	Het
Srebf2	C	T	15: 82,178,765	R468C	probably damaging	Het
Syt8	T	C	7: 142,438,268	I32T	probably benign	Het
Thumpd1	T	C	7: 119,720,585	N53D	possibly damaging	Het
Timm21	T	C	18: 84,951,138	T54A	probably benign	Het
Tmed10	A	G	12: 85,344,317	V149A	probably damaging	Het
Tmem108	T	A	9: 103,499,885	M122L	probably benign	Het
Tram1l1	A	G	3: 124,321,787	I199V	probably benign	Het
Tspan8	A	G	10: 115,839,897	N156S	probably benign	Het
Vars	T	C	17: 35,011,504	V521A	probably benign	Het
Vmn2r54	G	T	7: 12,615,816	T613N	possibly damaging	Het
Vps13b	T	A	15: 35,607,272	L1117*	probably null	Het
Vps33a	T	C	5: 123,533,952	K451R	probably benign	Het
Vsig10l	T	C	7: 43,463,729	I35T	probably benign	Het
Xpnpep3	T	A	15: 81,448,459	L399Q	probably damaging	Het
Zfp438	T	C	18: 5,214,013	E315G	probably benign	Het
Zfp467	C	T	6: 48,439,334	G128D	probably damaging	Het

Other mutations in Notch4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Notch4	APN	17	34575561	critical splice donor site	probably null
IGL01022:Notch4	APN	17	34565697	missense	probably damaging	1.00
IGL01356:Notch4	APN	17	34581026	missense	possibly damaging	0.67
IGL01634:Notch4	APN	17	34572588	missense	probably damaging	1.00
IGL02150:Notch4	APN	17	34584613	missense	probably damaging	1.00
IGL02248:Notch4	APN	17	34587198	missense	probably damaging	1.00
IGL02271:Notch4	APN	17	34568471	missense	probably damaging	1.00
IGL02299:Notch4	APN	17	34578004	missense	probably damaging	1.00
IGL02561:Notch4	APN	17	34568160	splice site	probably benign
IGL02604:Notch4	APN	17	34565388	splice site	probably null
IGL03323:Notch4	APN	17	34582471	missense	probably damaging	1.00
IGL03366:Notch4	APN	17	34572568	missense	probably damaging	1.00
IGL03408:Notch4	APN	17	34565568	missense	probably benign	0.03
K3955:Notch4	UTSW	17	34568462	missense	probably damaging	1.00
R0123:Notch4	UTSW	17	34565363	missense	possibly damaging	0.85
R0366:Notch4	UTSW	17	34581499	splice site	probably benign
R0446:Notch4	UTSW	17	34565363	missense	possibly damaging	0.85
R0490:Notch4	UTSW	17	34582890	missense	probably damaging	1.00
R0504:Notch4	UTSW	17	34575091	missense	probably damaging	1.00
R0545:Notch4	UTSW	17	34583433	missense	probably damaging	1.00
R0702:Notch4	UTSW	17	34575203	missense	probably damaging	1.00
R0763:Notch4	UTSW	17	34565332	nonsense	probably null
R0854:Notch4	UTSW	17	34568572	missense	probably damaging	1.00
R1082:Notch4	UTSW	17	34587390	missense	probably damaging	1.00
R1196:Notch4	UTSW	17	34568863	missense	probably damaging	1.00
R1316:Notch4	UTSW	17	34567470	missense	probably damaging	1.00
R1493:Notch4	UTSW	17	34567682	nonsense	probably null
R1527:Notch4	UTSW	17	34565744	missense	probably damaging	1.00
R1548:Notch4	UTSW	17	34568422	missense	probably damaging	1.00
R1718:Notch4	UTSW	17	34576763	splice site	probably benign
R1855:Notch4	UTSW	17	34580962	missense	probably benign	0.05
R1988:Notch4	UTSW	17	34587588	missense	possibly damaging	0.59
R2022:Notch4	UTSW	17	34587528	missense	probably damaging	1.00
R2023:Notch4	UTSW	17	34587528	missense	probably damaging	1.00
R2078:Notch4	UTSW	17	34568715	critical splice acceptor site	probably null
R2369:Notch4	UTSW	17	34585950	missense	probably benign	0.15
R3846:Notch4	UTSW	17	34578097	missense	probably damaging	1.00
R3874:Notch4	UTSW	17	34578069	nonsense	probably null
R4087:Notch4	UTSW	17	34584435	missense	probably damaging	1.00
R4456:Notch4	UTSW	17	34583833	missense	probably damaging	0.99
R4628:Notch4	UTSW	17	34570185	missense	probably damaging	1.00
R4728:Notch4	UTSW	17	34570205	missense	probably benign	0.00
R4778:Notch4	UTSW	17	34582511	missense	possibly damaging	0.95
R4818:Notch4	UTSW	17	34578716	splice site	probably benign
R4828:Notch4	UTSW	17	34570060	missense	probably damaging	1.00
R4830:Notch4	UTSW	17	34570118	missense	probably damaging	1.00
R4859:Notch4	UTSW	17	34587180	missense	probably damaging	1.00
R4871:Notch4	UTSW	17	34577562	missense	possibly damaging	0.63
R5090:Notch4	UTSW	17	34580920	missense	probably damaging	0.99
R5290:Notch4	UTSW	17	34565289	missense	probably benign	0.01
R5363:Notch4	UTSW	17	34587123	missense	probably damaging	1.00
R5860:Notch4	UTSW	17	34582418	missense	probably damaging	1.00
R6352:Notch4	UTSW	17	34567461	missense	probably damaging	1.00
R6385:Notch4	UTSW	17	34573814	missense	probably null	0.16
R6422:Notch4	UTSW	17	34584559	missense	probably benign
R6645:Notch4	UTSW	17	34587816	missense	probably benign	0.00
R6836:Notch4	UTSW	17	34586100	missense	probably damaging	0.96
R6943:Notch4	UTSW	17	34583603	missense	probably benign
R6991:Notch4	UTSW	17	34584800	nonsense	probably null
R7078:Notch4	UTSW	17	34582546	missense	possibly damaging	0.94
R7168:Notch4	UTSW	17	34572693	missense	probably benign	0.05
R7182:Notch4	UTSW	17	34583499	missense	probably damaging	1.00
R7240:Notch4	UTSW	17	34576471	missense	probably benign	0.00
R7247:Notch4	UTSW	17	34572517	missense	probably damaging	1.00
R7556:Notch4	UTSW	17	34575470	missense	probably damaging	1.00
R7571:Notch4	UTSW	17	34583574	missense	probably damaging	0.99
R7697:Notch4	UTSW	17	34570185	missense	probably damaging	1.00
R7763:Notch4	UTSW	17	34582418	missense	probably damaging	1.00
R7994:Notch4	UTSW	17	34578090	missense	possibly damaging	0.82
R8171:Notch4	UTSW	17	34582509	nonsense	probably null
R8375:Notch4	UTSW	17	34568254	missense	possibly damaging	0.90
R8448:Notch4	UTSW	17	34586789	splice site	probably null
X0054:Notch4	UTSW	17	34584495	missense	probably damaging	1.00
X0067:Notch4	UTSW	17	34586084	nonsense	probably null
Z1088:Notch4	UTSW	17	34587915	missense	probably damaging	1.00
Z1177:Notch4	UTSW	17	34575148	missense	probably damaging	1.00
Z1177:Notch4	UTSW	17	34587908	missense	probably damaging	0.97
Z1177:Notch4	UTSW	17	34587909	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CATTCGAAGGCCTCAGACAC -3'
(R):5'- GCGAAGGTCATTGAGTTGAC -3'

Sequencing Primer
(F):5'- GACAACATTGGTCTTAAGTGAGAC -3'
(R):5'- ATTGAGTTGACCTTGCCACTG -3'

Posted On

2020-06-30