Incidental Mutation 'R8139:Vars'
ID632443
Institutional Source Beutler Lab
Gene Symbol Vars
Ensembl Gene ENSMUSG00000007029
Gene Namevalyl-tRNA synthetase
SynonymsBat-6, Bat6, G7a, D17H6S56E, Vars2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R8139 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location35000987-35016322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35011504 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 521 (V521A)
Ref Sequence ENSEMBL: ENSMUSP00000133994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087315] [ENSMUST00000173584]
Predicted Effect probably benign
Transcript: ENSMUST00000087315
AA Change: V521A

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000084572
Gene: ENSMUSG00000007029
AA Change: V521A

DomainStartEndE-ValueType
Pfam:GST_N 2 81 5.7e-16 PFAM
Pfam:GST_C 107 198 7.3e-13 PFAM
low complexity region 234 256 N/A INTRINSIC
low complexity region 261 271 N/A INTRINSIC
Pfam:tRNA-synt_1 307 938 2e-197 PFAM
Pfam:tRNA-synt_1g 336 496 6e-6 PFAM
Pfam:tRNA-synt_1_2 555 623 1.9e-11 PFAM
Pfam:Anticodon_1 983 1138 2.6e-34 PFAM
low complexity region 1153 1174 N/A INTRINSIC
low complexity region 1207 1225 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173142
SMART Domains Protein: ENSMUSP00000134669
Gene: ENSMUSG00000007029

DomainStartEndE-ValueType
SCOP:d1gaxa3 32 67 3e-7 SMART
PDB:1IYW|B 36 122 4e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000173584
AA Change: V521A

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133994
Gene: ENSMUSG00000007029
AA Change: V521A

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
Pfam:GST_C 96 198 7.8e-14 PFAM
low complexity region 234 256 N/A INTRINSIC
low complexity region 261 271 N/A INTRINSIC
Pfam:tRNA-synt_1 307 938 1.9e-200 PFAM
Pfam:tRNA-synt_1g 336 493 2.1e-7 PFAM
Pfam:tRNA-synt_1_2 555 623 1.1e-12 PFAM
Pfam:Anticodon_1 983 1138 7.2e-36 PFAM
low complexity region 1153 1174 N/A INTRINSIC
coiled coil region 1197 1225 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. The protein encoded by this gene belongs to class-I aminoacyl-tRNA synthetase family and is located in the class III region of the major histocompatibility complex. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G T X: 70,394,514 Q58K possibly damaging Het
9130409I23Rik A G 1: 181,054,793 D40G probably damaging Het
Aamdc T C 7: 97,565,243 M42V probably benign Het
Abca6 T A 11: 110,184,133 Q1368L probably damaging Het
Best3 G A 10: 117,004,426 G254R probably damaging Het
Cacna1h A T 17: 25,383,723 I1478N probably damaging Het
Ccdc113 T A 8: 95,558,738 M350K possibly damaging Het
Cdc42bpa A T 1: 180,069,319 H389L probably damaging Het
Cnn3 G T 3: 121,455,069 M208I probably damaging Het
Col11a1 A G 3: 114,097,049 D345G unknown Het
Dnah14 G T 1: 181,755,288 V3131F probably damaging Het
Dst T A 1: 34,191,852 M2842K probably benign Het
Dus3l C T 17: 56,767,058 Q211* probably null Het
Eftud2 A G 11: 102,867,859 F171S probably benign Het
Elac2 T C 11: 64,980,614 I117T probably benign Het
Fam13b A G 18: 34,473,633 C302R possibly damaging Het
Fbxl5 G A 5: 43,758,745 Q442* probably null Het
Fhdc1 A G 3: 84,451,483 S370P probably damaging Het
Gm35911 A G 5: 99,924,926 I111V probably benign Het
I830077J02Rik A G 3: 105,927,998 V21A probably benign Het
Inf2 G T 12: 112,601,640 E209* probably null Het
Irs1 A T 1: 82,289,739 M252K probably damaging Het
Kcng3 C A 17: 83,631,087 V178L probably damaging Het
Kif16b A C 2: 142,901,365 S3A probably benign Het
Kit T C 5: 75,652,805 M884T probably damaging Het
Kmt2a A T 9: 44,819,290 probably benign Het
Kptn T C 7: 16,123,976 I243T probably benign Het
Loxhd1 G A 18: 77,380,496 E947K possibly damaging Het
Lyl1 A T 8: 84,702,847 I62L probably damaging Het
Mmp24 C T 2: 155,814,045 R468* probably null Het
Mrvi1 A G 7: 110,899,672 probably null Het
Mtx2 G A 2: 74,876,370 D230N probably benign Het
Ndufa5 A T 6: 24,522,758 Y28* probably null Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Nrxn3 A G 12: 90,204,664 N923S probably benign Het
Ogfod2 C T 5: 124,113,475 T116M possibly damaging Het
Olfr1220 A G 2: 89,097,843 V28A probably benign Het
Olfr492 T A 7: 108,322,906 T257S probably benign Het
Olfr835 A T 9: 19,035,575 I151F probably benign Het
Olfr846 A C 9: 19,361,208 V49G probably damaging Het
Oosp1 T C 19: 11,667,754 E182G possibly damaging Het
Oxnad1 C A 14: 32,092,091 T47K possibly damaging Het
Pcdha5 A G 18: 36,962,738 M767V possibly damaging Het
Pcnx3 A T 19: 5,665,745 H1444Q probably benign Het
Pde4dip G T 3: 97,696,993 Q2224K probably benign Het
Pgr A T 9: 8,956,340 H763L possibly damaging Het
Plec T C 15: 76,174,310 D3809G probably damaging Het
Ppfia1 A G 7: 144,520,693 S155P probably damaging Het
Ppfia4 A G 1: 134,300,528 V1090A probably benign Het
Ptgdr T C 14: 44,858,685 E190G probably benign Het
Rhbdd2 T A 5: 135,636,335 C173* probably null Het
Rhobtb1 C A 10: 69,266,290 P134T probably damaging Het
Slc25a36 A T 9: 97,080,452 F161L probably benign Het
Slc5a11 A G 7: 123,269,976 T596A probably benign Het
Slco1a6 T C 6: 142,089,900 Y566C probably damaging Het
Snx15 T G 19: 6,119,915 K321T probably damaging Het
Snx15 T C 19: 6,119,916 K321E probably damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Syt8 T C 7: 142,438,268 I32T probably benign Het
Thumpd1 T C 7: 119,720,585 N53D possibly damaging Het
Timm21 T C 18: 84,951,138 T54A probably benign Het
Tmed10 A G 12: 85,344,317 V149A probably damaging Het
Tmem108 T A 9: 103,499,885 M122L probably benign Het
Tram1l1 A G 3: 124,321,787 I199V probably benign Het
Tspan8 A G 10: 115,839,897 N156S probably benign Het
Vmn2r54 G T 7: 12,615,816 T613N possibly damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Vps33a T C 5: 123,533,952 K451R probably benign Het
Vsig10l T C 7: 43,463,729 I35T probably benign Het
Xpnpep3 T A 15: 81,448,459 L399Q probably damaging Het
Zfp438 T C 18: 5,214,013 E315G probably benign Het
Zfp467 C T 6: 48,439,334 G128D probably damaging Het
Other mutations in Vars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Vars APN 17 35013873 missense probably benign 0.00
IGL02160:Vars APN 17 35001502 missense probably damaging 1.00
IGL02303:Vars APN 17 35015484 splice site probably benign
IGL03027:Vars APN 17 35013687 missense probably damaging 1.00
Maladroit UTSW 17 35005475 missense probably benign 0.30
Whoops UTSW 17 35013644 missense probably damaging 1.00
FR4304:Vars UTSW 17 35015989 small insertion probably benign
FR4548:Vars UTSW 17 35015989 small insertion probably benign
FR4548:Vars UTSW 17 35015991 small insertion probably benign
FR4589:Vars UTSW 17 35015988 small insertion probably benign
R0045:Vars UTSW 17 35010619 missense probably damaging 1.00
R0045:Vars UTSW 17 34998066 missense probably benign 0.13
R0045:Vars UTSW 17 35010619 missense probably damaging 1.00
R0266:Vars UTSW 17 35013869 missense probably benign 0.00
R0267:Vars UTSW 17 35011596 splice site probably benign
R0391:Vars UTSW 17 35011486 missense possibly damaging 0.79
R0445:Vars UTSW 17 35011809 missense probably benign 0.31
R0449:Vars UTSW 17 35012727 splice site probably null
R0557:Vars UTSW 17 35004984 missense possibly damaging 0.90
R0559:Vars UTSW 17 35014058 nonsense probably null
R0730:Vars UTSW 17 35014300 missense probably damaging 1.00
R0748:Vars UTSW 17 34998012 missense probably damaging 1.00
R1692:Vars UTSW 17 35013725 missense probably damaging 1.00
R1693:Vars UTSW 17 34998196 missense probably benign 0.31
R1697:Vars UTSW 17 34998222 missense probably benign 0.43
R1699:Vars UTSW 17 35014758 missense possibly damaging 0.93
R1712:Vars UTSW 17 35014752 missense probably damaging 1.00
R1989:Vars UTSW 17 35011838 missense possibly damaging 0.94
R2349:Vars UTSW 17 35015752 missense probably benign
R2365:Vars UTSW 17 35015452 missense probably benign 0.01
R3790:Vars UTSW 17 34999334 missense probably benign 0.34
R4615:Vars UTSW 17 35013881 missense probably damaging 0.97
R4844:Vars UTSW 17 35011612 missense probably damaging 1.00
R4856:Vars UTSW 17 35015726 missense probably benign 0.37
R4886:Vars UTSW 17 35015726 missense probably benign 0.37
R5570:Vars UTSW 17 35016238 missense probably benign 0.04
R5706:Vars UTSW 17 35005481 unclassified probably null
R5858:Vars UTSW 17 35005475 missense probably benign 0.30
R5907:Vars UTSW 17 35012376 missense probably damaging 1.00
R5917:Vars UTSW 17 35012515 missense probably damaging 0.99
R5944:Vars UTSW 17 35013644 missense probably damaging 1.00
R6023:Vars UTSW 17 35001609 missense probably damaging 1.00
R6073:Vars UTSW 17 35001529 missense probably benign
R6273:Vars UTSW 17 35013743 missense probably damaging 1.00
R6390:Vars UTSW 17 35015639 missense probably benign 0.00
R6658:Vars UTSW 17 35015741 missense probably benign 0.03
R7067:Vars UTSW 17 35011479 missense probably damaging 0.98
R7387:Vars UTSW 17 35004792 nonsense probably null
R7954:Vars UTSW 17 35015984 missense probably benign 0.01
R8347:Vars UTSW 17 35015977 missense possibly damaging 0.92
R8387:Vars UTSW 17 35010514 missense probably damaging 0.99
Z1177:Vars UTSW 17 35011477 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTGAGGTGTGTCTCTGCC -3'
(R):5'- AGGACACAGGCACGAATGTC -3'

Sequencing Primer
(F):5'- AGGTGTGTCTCTGCCCACAG -3'
(R):5'- CACCTGGTATCTGGGATCCTTG -3'
Posted On2020-06-30