Incidental Mutation 'R8139:Fam13b'
ID 632447
Institutional Source Beutler Lab
Gene Symbol Fam13b
Ensembl Gene ENSMUSG00000036501
Gene Name family with sequence similarity 13, member B
Synonyms 2610024E20Rik
MMRRC Submission 067567-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.319) question?
Stock # R8139 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 34575404-34639884 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34606686 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 302 (C302R)
Ref Sequence ENSEMBL: ENSMUSP00000038199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040506]
AlphaFold Q8K2H3
Predicted Effect possibly damaging
Transcript: ENSMUST00000040506
AA Change: C302R

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038199
Gene: ENSMUSG00000036501
AA Change: C302R

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
RhoGAP 36 209 3.28e-44 SMART
coiled coil region 220 240 N/A INTRINSIC
low complexity region 280 295 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
coiled coil region 507 532 N/A INTRINSIC
low complexity region 719 726 N/A INTRINSIC
coiled coil region 778 807 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency 100% (84/84)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G T X: 69,438,120 (GRCm39) Q58K possibly damaging Het
Aamdc T C 7: 97,214,450 (GRCm39) M42V probably benign Het
Abca6 T A 11: 110,074,959 (GRCm39) Q1368L probably damaging Het
Best3 G A 10: 116,840,331 (GRCm39) G254R probably damaging Het
Cacna1h A T 17: 25,602,697 (GRCm39) I1478N probably damaging Het
Ccdc113 T A 8: 96,285,366 (GRCm39) M350K possibly damaging Het
Cdc42bpa A T 1: 179,896,884 (GRCm39) H389L probably damaging Het
Cnn3 G T 3: 121,248,718 (GRCm39) M208I probably damaging Het
Col11a1 A G 3: 113,890,698 (GRCm39) D345G unknown Het
Degs1l A G 1: 180,882,358 (GRCm39) D40G probably damaging Het
Dnah14 G T 1: 181,582,853 (GRCm39) V3131F probably damaging Het
Dst T A 1: 34,230,933 (GRCm39) M2842K probably benign Het
Dus3l C T 17: 57,074,058 (GRCm39) Q211* probably null Het
Eftud2 A G 11: 102,758,685 (GRCm39) F171S probably benign Het
Elac2 T C 11: 64,871,440 (GRCm39) I117T probably benign Het
Fbxl5 G A 5: 43,916,087 (GRCm39) Q442* probably null Het
Fhdc1 A G 3: 84,358,790 (GRCm39) S370P probably damaging Het
Gtf3c6 T C 10: 40,133,469 (GRCm39) probably null Het
I830077J02Rik A G 3: 105,835,314 (GRCm39) V21A probably benign Het
Inf2 G T 12: 112,568,074 (GRCm39) E209* probably null Het
Irag1 A G 7: 110,498,879 (GRCm39) probably null Het
Irs1 A T 1: 82,267,460 (GRCm39) M252K probably damaging Het
Kcng3 C A 17: 83,938,516 (GRCm39) V178L probably damaging Het
Kif16b A C 2: 142,743,285 (GRCm39) S3A probably benign Het
Kit T C 5: 75,813,465 (GRCm39) M884T probably damaging Het
Kmt2a A T 9: 44,730,587 (GRCm39) probably benign Het
Kptn T C 7: 15,857,901 (GRCm39) I243T probably benign Het
Loxhd1 G A 18: 77,468,192 (GRCm39) E947K possibly damaging Het
Lyl1 A T 8: 85,429,476 (GRCm39) I62L probably damaging Het
Mmp24 C T 2: 155,655,965 (GRCm39) R468* probably null Het
Mtx2 G A 2: 74,706,714 (GRCm39) D230N probably benign Het
Ndufa5 A T 6: 24,522,757 (GRCm39) Y28* probably null Het
Notch4 G T 17: 34,803,774 (GRCm39) E1515* probably null Het
Nrxn3 A G 12: 90,171,438 (GRCm39) N923S probably benign Het
Ogfod2 C T 5: 124,251,538 (GRCm39) T116M possibly damaging Het
Oosp1 T C 19: 11,645,118 (GRCm39) E182G possibly damaging Het
Or4c115 A G 2: 88,928,187 (GRCm39) V28A probably benign Het
Or5p67 T A 7: 107,922,113 (GRCm39) T257S probably benign Het
Or7g20 A T 9: 18,946,871 (GRCm39) I151F probably benign Het
Or7g28 A C 9: 19,272,504 (GRCm39) V49G probably damaging Het
Oxnad1 C A 14: 31,814,048 (GRCm39) T47K possibly damaging Het
Pcdha5 A G 18: 37,095,791 (GRCm39) M767V possibly damaging Het
Pcnx3 A T 19: 5,715,773 (GRCm39) H1444Q probably benign Het
Pde4dip G T 3: 97,604,309 (GRCm39) Q2224K probably benign Het
Pgr A T 9: 8,956,341 (GRCm39) H763L possibly damaging Het
Plec T C 15: 76,058,510 (GRCm39) D3809G probably damaging Het
Ppfia1 A G 7: 144,074,430 (GRCm39) S155P probably damaging Het
Ppfia4 A G 1: 134,228,266 (GRCm39) V1090A probably benign Het
Ptgdr T C 14: 45,096,142 (GRCm39) E190G probably benign Het
Rhbdd2 T A 5: 135,665,189 (GRCm39) C173* probably null Het
Rhobtb1 C A 10: 69,102,120 (GRCm39) P134T probably damaging Het
Slc25a36 A T 9: 96,962,505 (GRCm39) F161L probably benign Het
Slc5a11 A G 7: 122,869,199 (GRCm39) T596A probably benign Het
Slco1a6 T C 6: 142,035,626 (GRCm39) Y566C probably damaging Het
Snx15 T G 19: 6,169,945 (GRCm39) K321T probably damaging Het
Snx15 T C 19: 6,169,946 (GRCm39) K321E probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Syt8 T C 7: 141,992,005 (GRCm39) I32T probably benign Het
Thumpd1 T C 7: 119,319,808 (GRCm39) N53D possibly damaging Het
Timm21 T C 18: 84,969,263 (GRCm39) T54A probably benign Het
Tmed10 A G 12: 85,391,091 (GRCm39) V149A probably damaging Het
Tmem108 T A 9: 103,377,084 (GRCm39) M122L probably benign Het
Tram1l1 A G 3: 124,115,436 (GRCm39) I199V probably benign Het
Tspan8 A G 10: 115,675,802 (GRCm39) N156S probably benign Het
Vamp9 A G 5: 100,072,785 (GRCm39) I111V probably benign Het
Vars1 T C 17: 35,230,480 (GRCm39) V521A probably benign Het
Vmn2r54 G T 7: 12,349,743 (GRCm39) T613N possibly damaging Het
Vps13b T A 15: 35,607,418 (GRCm39) L1117* probably null Het
Vps33a T C 5: 123,672,015 (GRCm39) K451R probably benign Het
Vsig10l T C 7: 43,113,153 (GRCm39) I35T probably benign Het
Xpnpep3 T A 15: 81,332,660 (GRCm39) L399Q probably damaging Het
Zfp438 T C 18: 5,214,013 (GRCm39) E315G probably benign Het
Zfp467 C T 6: 48,416,268 (GRCm39) G128D probably damaging Het
Other mutations in Fam13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Fam13b APN 18 34,620,149 (GRCm39) missense possibly damaging 0.92
IGL00402:Fam13b APN 18 34,587,771 (GRCm39) missense probably damaging 1.00
IGL00556:Fam13b APN 18 34,630,488 (GRCm39) missense probably damaging 0.99
IGL02123:Fam13b APN 18 34,578,671 (GRCm39) unclassified probably benign
IGL02313:Fam13b APN 18 34,587,709 (GRCm39) missense probably damaging 1.00
IGL02346:Fam13b APN 18 34,595,158 (GRCm39) missense probably benign 0.00
IGL02347:Fam13b APN 18 34,587,757 (GRCm39) missense probably damaging 1.00
IGL02694:Fam13b APN 18 34,584,259 (GRCm39) critical splice donor site probably null
IGL03347:Fam13b APN 18 34,595,104 (GRCm39) splice site probably benign
R0109:Fam13b UTSW 18 34,584,361 (GRCm39) missense probably benign 0.00
R0233:Fam13b UTSW 18 34,581,137 (GRCm39) missense probably damaging 1.00
R0455:Fam13b UTSW 18 34,578,581 (GRCm39) unclassified probably benign
R1229:Fam13b UTSW 18 34,578,636 (GRCm39) missense probably benign 0.05
R1397:Fam13b UTSW 18 34,578,636 (GRCm39) missense probably benign 0.05
R1571:Fam13b UTSW 18 34,630,485 (GRCm39) missense possibly damaging 0.92
R1703:Fam13b UTSW 18 34,584,492 (GRCm39) critical splice acceptor site probably null
R1732:Fam13b UTSW 18 34,620,187 (GRCm39) missense probably benign 0.04
R1777:Fam13b UTSW 18 34,590,813 (GRCm39) missense possibly damaging 0.84
R1956:Fam13b UTSW 18 34,578,382 (GRCm39) missense possibly damaging 0.69
R2296:Fam13b UTSW 18 34,627,814 (GRCm39) missense possibly damaging 0.88
R3881:Fam13b UTSW 18 34,595,112 (GRCm39) critical splice donor site probably null
R3896:Fam13b UTSW 18 34,596,008 (GRCm39) splice site probably benign
R5277:Fam13b UTSW 18 34,595,243 (GRCm39) missense probably benign
R5759:Fam13b UTSW 18 34,630,488 (GRCm39) missense probably damaging 0.99
R5817:Fam13b UTSW 18 34,590,850 (GRCm39) missense possibly damaging 0.93
R5897:Fam13b UTSW 18 34,587,134 (GRCm39) missense possibly damaging 0.83
R6009:Fam13b UTSW 18 34,630,458 (GRCm39) missense possibly damaging 0.92
R6020:Fam13b UTSW 18 34,627,827 (GRCm39) missense probably damaging 1.00
R6087:Fam13b UTSW 18 34,620,192 (GRCm39) missense possibly damaging 0.48
R6151:Fam13b UTSW 18 34,627,330 (GRCm39) missense probably damaging 0.96
R6454:Fam13b UTSW 18 34,590,715 (GRCm39) critical splice donor site probably null
R6464:Fam13b UTSW 18 34,606,684 (GRCm39) nonsense probably null
R6679:Fam13b UTSW 18 34,620,075 (GRCm39) missense possibly damaging 0.53
R6723:Fam13b UTSW 18 34,631,079 (GRCm39) missense possibly damaging 0.86
R6990:Fam13b UTSW 18 34,630,500 (GRCm39) missense possibly damaging 0.92
R7420:Fam13b UTSW 18 34,627,664 (GRCm39) missense probably damaging 1.00
R7517:Fam13b UTSW 18 34,627,660 (GRCm39) missense probably damaging 0.98
R7534:Fam13b UTSW 18 34,631,060 (GRCm39) missense probably damaging 0.97
R7889:Fam13b UTSW 18 34,590,744 (GRCm39) missense probably benign 0.00
R8776:Fam13b UTSW 18 34,584,446 (GRCm39) missense probably damaging 1.00
R8776-TAIL:Fam13b UTSW 18 34,584,446 (GRCm39) missense probably damaging 1.00
R8826:Fam13b UTSW 18 34,631,070 (GRCm39) missense probably damaging 0.96
R9166:Fam13b UTSW 18 34,595,252 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CGATTGATAACCGAGACAAGTATG -3'
(R):5'- AGGCTTCTATCTCAGGGCAAAC -3'

Sequencing Primer
(F):5'- GTATGTCAGCAAAATCACTCAACTG -3'
(R):5'- ACTCATGTAGTCCAGGCTGAC -3'
Posted On 2020-06-30