Incidental Mutation 'R8139:Snx15'
ID632453
Institutional Source Beutler Lab
Gene Symbol Snx15
Ensembl Gene ENSMUSG00000024787
Gene Namesorting nexin 15
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8139 (G1)
Quality Score159.009
Status Validated
Chromosome19
Chromosomal Location6119399-6128304 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6119916 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 321 (K321E)
Ref Sequence ENSEMBL: ENSMUSP00000025702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025702] [ENSMUST00000044451] [ENSMUST00000113533] [ENSMUST00000138931] [ENSMUST00000154601]
Predicted Effect probably damaging
Transcript: ENSMUST00000025702
AA Change: K321E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025702
Gene: ENSMUSG00000024787
AA Change: K321E

DomainStartEndE-ValueType
PX 8 126 1.78e-22 SMART
low complexity region 140 151 N/A INTRINSIC
MIT 265 337 7.77e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044451
SMART Domains Protein: ENSMUSP00000044231
Gene: ENSMUSG00000054999

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
Pfam:PA 163 256 3e-12 PFAM
Pfam:Peptidase_M28 353 564 1.3e-22 PFAM
low complexity region 579 592 N/A INTRINSIC
Pfam:TFR_dimer 621 740 4.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113533
SMART Domains Protein: ENSMUSP00000109161
Gene: ENSMUSG00000024790

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
Pfam:SAC3_GANP 134 356 7.6e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138931
SMART Domains Protein: ENSMUSP00000114189
Gene: ENSMUSG00000024787

DomainStartEndE-ValueType
PX 8 112 1.69e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154601
AA Change: K235E

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122740
Gene: ENSMUSG00000024787
AA Change: K235E

DomainStartEndE-ValueType
PX 8 126 1.78e-22 SMART
low complexity region 140 151 N/A INTRINSIC
Blast:MIT 222 251 4e-12 BLAST
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. Overexpression of this gene results in a decrease in the processing of insulin and hepatocyte growth factor receptors to their mature subunits. This decrease is caused by the mislocalization of furin, the endoprotease responsible for cleavage of insulin and hepatocyte growth factor receptors. This protein is involved in endosomal trafficking from the plasma membrane to recycling endosomes or the trans-Golgi network. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream ADP-ribosylation factor-like 2 (ARL2) gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G T X: 70,394,514 Q58K possibly damaging Het
9130409I23Rik A G 1: 181,054,793 D40G probably damaging Het
Aamdc T C 7: 97,565,243 M42V probably benign Het
Abca6 T A 11: 110,184,133 Q1368L probably damaging Het
Best3 G A 10: 117,004,426 G254R probably damaging Het
Cacna1h A T 17: 25,383,723 I1478N probably damaging Het
Ccdc113 T A 8: 95,558,738 M350K possibly damaging Het
Cdc42bpa A T 1: 180,069,319 H389L probably damaging Het
Cnn3 G T 3: 121,455,069 M208I probably damaging Het
Col11a1 A G 3: 114,097,049 D345G unknown Het
Dnah14 G T 1: 181,755,288 V3131F probably damaging Het
Dst T A 1: 34,191,852 M2842K probably benign Het
Dus3l C T 17: 56,767,058 Q211* probably null Het
Eftud2 A G 11: 102,867,859 F171S probably benign Het
Elac2 T C 11: 64,980,614 I117T probably benign Het
Fam13b A G 18: 34,473,633 C302R possibly damaging Het
Fbxl5 G A 5: 43,758,745 Q442* probably null Het
Fhdc1 A G 3: 84,451,483 S370P probably damaging Het
Gm35911 A G 5: 99,924,926 I111V probably benign Het
Gtf3c6 T C 10: 40,257,473 probably null Het
I830077J02Rik A G 3: 105,927,998 V21A probably benign Het
Inf2 G T 12: 112,601,640 E209* probably null Het
Irs1 A T 1: 82,289,739 M252K probably damaging Het
Kcng3 C A 17: 83,631,087 V178L probably damaging Het
Kif16b A C 2: 142,901,365 S3A probably benign Het
Kit T C 5: 75,652,805 M884T probably damaging Het
Kmt2a A T 9: 44,819,290 probably benign Het
Kptn T C 7: 16,123,976 I243T probably benign Het
Loxhd1 G A 18: 77,380,496 E947K possibly damaging Het
Lyl1 A T 8: 84,702,847 I62L probably damaging Het
Mmp24 C T 2: 155,814,045 R468* probably null Het
Mrvi1 A G 7: 110,899,672 probably null Het
Mtx2 G A 2: 74,876,370 D230N probably benign Het
Ndufa5 A T 6: 24,522,758 Y28* probably null Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Nrxn3 A G 12: 90,204,664 N923S probably benign Het
Ogfod2 C T 5: 124,113,475 T116M possibly damaging Het
Olfr1220 A G 2: 89,097,843 V28A probably benign Het
Olfr492 T A 7: 108,322,906 T257S probably benign Het
Olfr835 A T 9: 19,035,575 I151F probably benign Het
Olfr846 A C 9: 19,361,208 V49G probably damaging Het
Oosp1 T C 19: 11,667,754 E182G possibly damaging Het
Oxnad1 C A 14: 32,092,091 T47K possibly damaging Het
Pcdha5 A G 18: 36,962,738 M767V possibly damaging Het
Pcnx3 A T 19: 5,665,745 H1444Q probably benign Het
Pde4dip G T 3: 97,696,993 Q2224K probably benign Het
Pgr A T 9: 8,956,340 H763L possibly damaging Het
Plec T C 15: 76,174,310 D3809G probably damaging Het
Ppfia1 A G 7: 144,520,693 S155P probably damaging Het
Ppfia4 A G 1: 134,300,528 V1090A probably benign Het
Ptgdr T C 14: 44,858,685 E190G probably benign Het
Rhbdd2 T A 5: 135,636,335 C173* probably null Het
Rhobtb1 C A 10: 69,266,290 P134T probably damaging Het
Slc25a36 A T 9: 97,080,452 F161L probably benign Het
Slc5a11 A G 7: 123,269,976 T596A probably benign Het
Slco1a6 T C 6: 142,089,900 Y566C probably damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Syt8 T C 7: 142,438,268 I32T probably benign Het
Thumpd1 T C 7: 119,720,585 N53D possibly damaging Het
Timm21 T C 18: 84,951,138 T54A probably benign Het
Tmed10 A G 12: 85,344,317 V149A probably damaging Het
Tmem108 T A 9: 103,499,885 M122L probably benign Het
Tram1l1 A G 3: 124,321,787 I199V probably benign Het
Tspan8 A G 10: 115,839,897 N156S probably benign Het
Vars T C 17: 35,011,504 V521A probably benign Het
Vmn2r54 G T 7: 12,615,816 T613N possibly damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Vps33a T C 5: 123,533,952 K451R probably benign Het
Vsig10l T C 7: 43,463,729 I35T probably benign Het
Xpnpep3 T A 15: 81,448,459 L399Q probably damaging Het
Zfp438 T C 18: 5,214,013 E315G probably benign Het
Zfp467 C T 6: 48,439,334 G128D probably damaging Het
Other mutations in Snx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Snx15 APN 19 6119885 missense probably benign 0.00
IGL02102:Snx15 APN 19 6122074 missense possibly damaging 0.69
PIT4418001:Snx15 UTSW 19 6123931 missense probably damaging 1.00
R0079:Snx15 UTSW 19 6123913 missense probably damaging 1.00
R0654:Snx15 UTSW 19 6121885 missense probably benign 0.33
R1499:Snx15 UTSW 19 6122064 missense probably damaging 1.00
R1943:Snx15 UTSW 19 6128066 missense probably damaging 1.00
R2991:Snx15 UTSW 19 6121485 missense probably damaging 0.99
R3769:Snx15 UTSW 19 6123954 splice site probably benign
R5117:Snx15 UTSW 19 6124151 critical splice donor site probably null
R5763:Snx15 UTSW 19 6122110 missense probably damaging 0.99
R6219:Snx15 UTSW 19 6121508 missense probably damaging 0.99
R7024:Snx15 UTSW 19 6120596 missense probably damaging 0.98
R7297:Snx15 UTSW 19 6120507 missense probably damaging 1.00
R8139:Snx15 UTSW 19 6119915 missense probably damaging 1.00
Z1088:Snx15 UTSW 19 6121411 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTAATTCCAAGGAGGCAGGC -3'
(R):5'- ACACTGGGCAGAATTTTCCC -3'

Sequencing Primer
(F):5'- TCAGAGCTGAGAAGTCTTTGC -3'
(R):5'- TGAATGTAGGTGGGCCAT -3'
Posted On2020-06-30