Mutagenetix > Incidental Mutation

Incidental Mutation 'R8140:Cpa6'

632456

Institutional Source

Beutler Lab

Gene Symbol

Cpa6

Ensembl Gene

ENSMUSG00000042501

Gene Name

carboxypeptidase A6

Synonyms

9030616D13Rik

MMRRC Submission

067568-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.210) question?

Stock #

R8140 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

10324720-10719945 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 10325294 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 383 (S383P)

Ref Sequence

ENSEMBL: ENSMUSP00000035435 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035577] [ENSMUST00000153695]

AlphaFold

Q5U901

Predicted Effect

probably damaging
Transcript: ENSMUST00000035577
AA Change: S383P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035435
Gene: ENSMUSG00000042501
AA Change: S383P

Domain	Start	End	E-Value	Type
Pfam:Propep_M14	43	119	3.1e-17	PFAM
Zn_pept	139	421	2.19e-123	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000153695

SMART Domains

Protein: ENSMUSP00000118341
Gene: ENSMUSG00000042501

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
SCOP:d1kwma2	31	64	2e-4	SMART

Meta Mutation Damage Score

0.9140

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 93.9%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: This gene encodes a protein that belongs to the metallocarboxypeptidase family of proteins that catalyze the release of a C-terminal amino acid from the target protein. The encoded preproprotein undergoes proteolytic cleavage to yield the mature form which is thought to play a role in cell migration. In humans, this protein regulates neuropeptides in the brain and mutations in this gene are associated with a recessive familial form of febrile seizures and with temporal lobe epilepsy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2014]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,611	V230E	possibly damaging	Het
Amotl1	G	A	9: 14,572,715		probably null	Het
Atp7b	C	A	8: 22,028,560	E87D	probably damaging	Het
Bcat2	C	T	7: 45,588,351	P347L	probably damaging	Het
Brox	A	T	1: 183,293,873		probably null	Het
Cd37	A	G	7: 45,238,535	I58T	probably damaging	Het
Cep295	A	T	9: 15,341,533	M333K	probably benign	Het
Chtop	A	G	3: 90,505,393		probably null	Het
Cpa2	A	T	6: 30,544,905	K54N	probably benign	Het
Dnah7a	A	T	1: 53,501,589	I2542N	probably benign	Het
Eif5b	G	A	1: 38,051,276	V1179I	probably benign	Het
Erbin	T	C	13: 103,920,294		probably null	Het
Fastkd5	A	T	2: 130,615,250	D473E	possibly damaging	Het
Fchsd1	T	C	18: 37,964,342	E372G	probably damaging	Het
Fgl1	T	C	8: 41,200,609		probably null	Het
Fzd8	T	G	18: 9,213,797	V293G	probably damaging	Het
Gm4787	T	A	12: 81,378,151	H411L	probably benign	Het
Gm49380	G	T	9: 44,111,972	D326E	probably benign	Het
Hcrtr1	G	A	4: 130,135,290	R240C	probably damaging	Het
Hdac5	A	T	11: 102,197,355	Y948N	probably damaging	Het
Hepacam	A	G	9: 37,383,871	S301G	probably benign	Het
Htra4	A	T	8: 25,030,558	D362E	possibly damaging	Het
Ighv1-9	G	A	12: 114,583,741	P60L	probably damaging	Het
Kcnq3	A	G	15: 65,995,541	I751T	probably damaging	Het
Magi3	T	C	3: 104,034,086	Y851C	probably damaging	Het
Mefv	A	G	16: 3,713,635	S470P	probably benign	Het
Mfsd2a	C	T	4: 122,949,298	V397I	probably benign	Het
Mroh1	C	A	15: 76,433,873	H867N	probably benign	Het
Mthfd1l	C	T	10: 4,007,745	R261*	probably null	Het
Myo3a	A	G	2: 22,407,346	I725M	probably damaging	Het
Neb	T	C	2: 52,209,540	D4766G	possibly damaging	Het
Nek11	G	T	9: 105,392,957	P22Q	probably damaging	Het
Olfr1179	T	C	2: 88,402,113	T274A	possibly damaging	Het
Olfr1497	A	T	19: 13,795,239	V124E	possibly damaging	Het
Olfr178	T	C	16: 58,889,585	T212A	probably benign	Het
Peg10	C	G	6: 4,756,113	Q230E	unknown	Het
Pipox	T	C	11: 77,883,909	D116G	probably benign	Het
Pkd1l2	C	T	8: 117,047,497	R993H	probably benign	Het
Pkdrej	A	C	15: 85,818,410	N1108K	probably damaging	Het
Polr2a	C	T	11: 69,746,376	R291Q	probably benign	Het
Pomt1	T	A	2: 32,244,297	Y277N	probably damaging	Het
Rasal2	A	G	1: 157,299,235	S78P	probably damaging	Het
Rgl1	A	T	1: 152,557,501	L171Q	probably damaging	Het
Sfta2	A	G	17: 35,601,774	E14G	unknown	Het
Sh3rf3	T	A	10: 59,049,355	S353R	possibly damaging	Het
Slc37a1	A	T	17: 31,322,259	I242F	probably damaging	Het
Srfbp1	T	A	18: 52,488,690	D274E	probably damaging	Het
Syne2	T	A	12: 75,912,353	S685R	possibly damaging	Het
Tenm4	A	C	7: 96,895,176	D2170A	probably damaging	Het
Tnr	A	G	1: 159,863,695	T472A	probably damaging	Het
Tspan9	T	C	6: 127,965,278	H203R	probably damaging	Het
Ttn	T	C	2: 76,771,651	T18556A	possibly damaging	Het
Usp25	T	A	16: 77,071,681	Y323*	probably null	Het
Usp31	G	T	7: 121,649,026	R1065S	possibly damaging	Het
Vmn2r103	A	T	17: 19,811,796	T611S	probably damaging	Het
Wdfy4	A	G	14: 33,142,360	V552A		Het
Zap70	G	T	1: 36,771,181	R124L	possibly damaging	Het
Zfand6	A	T	7: 84,632,749	S91T	possibly damaging	Het

Other mutations in Cpa6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00858:Cpa6	APN	1	10483994	missense	probably damaging	1.00
IGL00933:Cpa6	APN	1	10337370	missense	probably benign	0.03
IGL01710:Cpa6	APN	1	10325272	missense	probably damaging	0.99
IGL02211:Cpa6	APN	1	10595636	missense	possibly damaging	0.83
IGL02504:Cpa6	APN	1	10488919	missense	probably benign	0.19
R0487:Cpa6	UTSW	1	10409262	missense	possibly damaging	0.77
R1260:Cpa6	UTSW	1	10325319	splice site	probably null
R2154:Cpa6	UTSW	1	10337322	missense	probably damaging	1.00
R4705:Cpa6	UTSW	1	10481058	missense	probably benign	0.03
R4788:Cpa6	UTSW	1	10408277	missense	possibly damaging	0.95
R4872:Cpa6	UTSW	1	10595618	critical splice donor site	probably null
R4941:Cpa6	UTSW	1	10409337	missense	probably benign	0.25
R5656:Cpa6	UTSW	1	10329514	missense	probably benign	0.19
R5969:Cpa6	UTSW	1	10488883	missense	probably benign	0.15
R6019:Cpa6	UTSW	1	10595643	missense	possibly damaging	0.88
R6322:Cpa6	UTSW	1	10477121	missense	possibly damaging	0.77
R6958:Cpa6	UTSW	1	10595688	missense	probably damaging	1.00
R7154:Cpa6	UTSW	1	10337469	missense	possibly damaging	0.71
R7274:Cpa6	UTSW	1	10409299	missense	probably damaging	1.00
R8559:Cpa6	UTSW	1	10408349	nonsense	probably null
R9042:Cpa6	UTSW	1	10337290	missense	probably benign	0.05
R9297:Cpa6	UTSW	1	10484048	missense	possibly damaging	0.95
R9355:Cpa6	UTSW	1	10409295	missense	probably benign	0.09
R9498:Cpa6	UTSW	1	10409321	missense	possibly damaging	0.73
Z1177:Cpa6	UTSW	1	10329559	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGCCAAGGTGCCTTTTGATC -3'
(R):5'- CCAGATGCTGAAGAACACTGTTAG -3'

Sequencing Primer
(F):5'- GACTAGATGACTGTTCCTCTCAAGG -3'
(R):5'- TGCTGAAGAACACTGTTAGAATATTC -3'

Posted On

2020-06-30