Mutagenetix > Incidental Mutation

Incidental Mutation 'R8140:Rgl1'

632459

Institutional Source

Beutler Lab

Gene Symbol

Rgl1

Ensembl Gene

ENSMUSG00000026482

Gene Name

ral guanine nucleotide dissociation stimulator,-like 1

Synonyms

Rgl

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.260) question?

Stock #

R8140 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

152516760-152766351 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 152557501 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 171 (L171Q)

Ref Sequence

ENSEMBL: ENSMUSP00000027760 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027760] [ENSMUST00000111857] [ENSMUST00000111859] [ENSMUST00000149536]

AlphaFold

Q60695

PDB Structure

SOLUTION STRUCTURE OF THE RAS-BINDING DOMAIN OF RGL [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027760
AA Change: L171Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027760
Gene: ENSMUSG00000026482
AA Change: L171Q

Domain	Start	End	E-Value	Type
RasGEFN	64	196	5.86e-39	SMART
RasGEF	228	502	9.56e-116	SMART
Blast:RasGEF	522	582	6e-8	BLAST
low complexity region	585	596	N/A	INTRINSIC
low complexity region	627	637	N/A	INTRINSIC
RA	648	735	1.7e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111857
AA Change: L169Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107488
Gene: ENSMUSG00000026482
AA Change: L169Q

Domain	Start	End	E-Value	Type
RasGEFN	62	194	5.86e-39	SMART
RasGEF	226	500	9.56e-116	SMART
Blast:RasGEF	520	580	7e-8	BLAST
low complexity region	583	594	N/A	INTRINSIC
low complexity region	625	635	N/A	INTRINSIC
RA	646	733	1.7e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111859
AA Change: L206Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107490
Gene: ENSMUSG00000026482
AA Change: L206Q

Domain	Start	End	E-Value	Type
RasGEFN	99	231	5.86e-39	SMART
RasGEF	263	537	9.56e-116	SMART
Blast:RasGEF	557	617	6e-8	BLAST
low complexity region	620	631	N/A	INTRINSIC
low complexity region	662	672	N/A	INTRINSIC
RA	683	770	1.7e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149536

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 93.9%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: This gene encodes a member of the Ras-like (Ral) -selective guanine nucleotide exchange factor (RalGEF) family of small GTPase activators which function both as downstream effectors of activated Ras GTPase and as regulators of certain Ral GTPases in the RalGEF - Ral GTPase signaling pathway. The encoded protein, like other RalGEFs, has an N-terminal ras exchanger motif domain, a catalytic CDC25 homology domain, and a C-terminal ras binding domain that stimulates guanine nucleotide exchange when bound to a Ral GTPase. RalGEF family members bridge the Ras and Ral signaling pathways and are thought to play a role in oncogenic transformation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,611	V230E	possibly damaging	Het
Amotl1	G	A	9: 14,572,715		probably null	Het
Atp7b	C	A	8: 22,028,560	E87D	probably damaging	Het
Bcat2	C	T	7: 45,588,351	P347L	probably damaging	Het
Brox	A	T	1: 183,293,873		probably null	Het
Cd37	A	G	7: 45,238,535	I58T	probably damaging	Het
Cep295	A	T	9: 15,341,533	M333K	probably benign	Het
Chtop	A	G	3: 90,505,393		probably null	Het
Cpa2	A	T	6: 30,544,905	K54N	probably benign	Het
Cpa6	A	G	1: 10,325,294	S383P	probably damaging	Het
Dnah7a	A	T	1: 53,501,589	I2542N	probably benign	Het
Eif5b	G	A	1: 38,051,276	V1179I	probably benign	Het
Erbin	T	C	13: 103,920,294		probably null	Het
Fastkd5	A	T	2: 130,615,250	D473E	possibly damaging	Het
Fchsd1	T	C	18: 37,964,342	E372G	probably damaging	Het
Fgl1	T	C	8: 41,200,609		probably null	Het
Fzd8	T	G	18: 9,213,797	V293G	probably damaging	Het
Gm4787	T	A	12: 81,378,151	H411L	probably benign	Het
Gm49380	G	T	9: 44,111,972	D326E	probably benign	Het
Hcrtr1	G	A	4: 130,135,290	R240C	probably damaging	Het
Hdac5	A	T	11: 102,197,355	Y948N	probably damaging	Het
Hepacam	A	G	9: 37,383,871	S301G	probably benign	Het
Htra4	A	T	8: 25,030,558	D362E	possibly damaging	Het
Ighv1-9	G	A	12: 114,583,741	P60L	probably damaging	Het
Kcnq3	A	G	15: 65,995,541	I751T	probably damaging	Het
Magi3	T	C	3: 104,034,086	Y851C	probably damaging	Het
Mefv	A	G	16: 3,713,635	S470P	probably benign	Het
Mfsd2a	C	T	4: 122,949,298	V397I	probably benign	Het
Mroh1	C	A	15: 76,433,873	H867N	probably benign	Het
Mthfd1l	C	T	10: 4,007,745	R261*	probably null	Het
Myo3a	A	G	2: 22,407,346	I725M	probably damaging	Het
Neb	T	C	2: 52,209,540	D4766G	possibly damaging	Het
Nek11	G	T	9: 105,392,957	P22Q	probably damaging	Het
Olfr1179	T	C	2: 88,402,113	T274A	possibly damaging	Het
Olfr1497	A	T	19: 13,795,239	V124E	possibly damaging	Het
Olfr178	T	C	16: 58,889,585	T212A	probably benign	Het
Peg10	C	G	6: 4,756,113	Q230E	unknown	Het
Pipox	T	C	11: 77,883,909	D116G	probably benign	Het
Pkd1l2	C	T	8: 117,047,497	R993H	probably benign	Het
Pkdrej	A	C	15: 85,818,410	N1108K	probably damaging	Het
Polr2a	C	T	11: 69,746,376	R291Q	probably benign	Het
Pomt1	T	A	2: 32,244,297	Y277N	probably damaging	Het
Rasal2	A	G	1: 157,299,235	S78P	probably damaging	Het
Sfta2	A	G	17: 35,601,774	E14G	unknown	Het
Sh3rf3	T	A	10: 59,049,355	S353R	possibly damaging	Het
Slc37a1	A	T	17: 31,322,259	I242F	probably damaging	Het
Srfbp1	T	A	18: 52,488,690	D274E	probably damaging	Het
Syne2	T	A	12: 75,912,353	S685R	possibly damaging	Het
Tenm4	A	C	7: 96,895,176	D2170A	probably damaging	Het
Tnr	A	G	1: 159,863,695	T472A	probably damaging	Het
Tspan9	T	C	6: 127,965,278	H203R	probably damaging	Het
Ttn	T	C	2: 76,771,651	T18556A	possibly damaging	Het
Usp25	T	A	16: 77,071,681	Y323*	probably null	Het
Usp31	G	T	7: 121,649,026	R1065S	possibly damaging	Het
Vmn2r103	A	T	17: 19,811,796	T611S	probably damaging	Het
Wdfy4	A	G	14: 33,142,360	V552A		Het
Zap70	G	T	1: 36,771,181	R124L	possibly damaging	Het
Zfand6	A	T	7: 84,632,749	S91T	possibly damaging	Het

Other mutations in Rgl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Rgl1	APN	1	152571617	missense	probably benign	0.02
IGL01065:Rgl1	APN	1	152519142	missense	probably damaging	1.00
IGL01390:Rgl1	APN	1	152571588	splice site	probably benign
IGL01726:Rgl1	APN	1	152519153	missense	probably damaging	1.00
IGL01837:Rgl1	APN	1	152549150	missense	probably damaging	1.00
IGL02019:Rgl1	APN	1	152528469	splice site	probably benign
IGL02369:Rgl1	APN	1	152533606	missense	probably damaging	1.00
R0240:Rgl1	UTSW	1	152554424	unclassified	probably benign
R0255:Rgl1	UTSW	1	152552596	missense	probably damaging	1.00
R0562:Rgl1	UTSW	1	152539945	missense	probably damaging	1.00
R0648:Rgl1	UTSW	1	152536265	critical splice donor site	probably null
R0734:Rgl1	UTSW	1	152554300	missense	probably damaging	0.98
R1187:Rgl1	UTSW	1	152544433	missense	probably benign	0.14
R1522:Rgl1	UTSW	1	152586533	missense	probably damaging	1.00
R1595:Rgl1	UTSW	1	152675023	splice site	probably benign
R1634:Rgl1	UTSW	1	152524772	missense	probably damaging	1.00
R1661:Rgl1	UTSW	1	152533575	missense	probably damaging	0.99
R1665:Rgl1	UTSW	1	152533575	missense	probably damaging	0.99
R1964:Rgl1	UTSW	1	152549104	missense	probably damaging	1.00
R2291:Rgl1	UTSW	1	152536281	missense	probably damaging	1.00
R4272:Rgl1	UTSW	1	152536289	missense	probably benign	0.13
R4668:Rgl1	UTSW	1	152521371	missense	probably damaging	1.00
R4669:Rgl1	UTSW	1	152521371	missense	probably damaging	1.00
R4747:Rgl1	UTSW	1	152524699	nonsense	probably null
R4830:Rgl1	UTSW	1	152554330	missense	probably benign	0.11
R4853:Rgl1	UTSW	1	152557574	missense	probably benign	0.07
R4969:Rgl1	UTSW	1	152549062	splice site	probably null
R5778:Rgl1	UTSW	1	152552421	missense	probably benign	0.05
R5979:Rgl1	UTSW	1	152557493	missense	probably damaging	1.00
R6180:Rgl1	UTSW	1	152519172	missense	probably damaging	1.00
R6183:Rgl1	UTSW	1	152586570	missense	possibly damaging	0.94
R6322:Rgl1	UTSW	1	152552435	missense	probably damaging	0.98
R6678:Rgl1	UTSW	1	152524724	missense	probably damaging	1.00
R6759:Rgl1	UTSW	1	152533530	missense	probably damaging	0.99
R6892:Rgl1	UTSW	1	152539940	missense	probably benign	0.00
R7290:Rgl1	UTSW	1	152544395	missense	possibly damaging	0.78
R7363:Rgl1	UTSW	1	152519163	missense	probably damaging	1.00
R7610:Rgl1	UTSW	1	152552620	missense	probably damaging	1.00
R7774:Rgl1	UTSW	1	152554350	missense	probably benign
R9188:Rgl1	UTSW	1	152519171	missense	probably damaging	1.00
R9190:Rgl1	UTSW	1	152552611	missense	probably damaging	0.96
R9297:Rgl1	UTSW	1	152524703	missense	possibly damaging	0.89
R9318:Rgl1	UTSW	1	152524703	missense	possibly damaging	0.89
R9491:Rgl1	UTSW	1	152549118	missense	probably damaging	1.00
R9570:Rgl1	UTSW	1	152554331	missense	possibly damaging	0.47
R9610:Rgl1	UTSW	1	152521364	missense	probably benign	0.13
R9640:Rgl1	UTSW	1	152521391	missense	probably damaging	1.00
RF005:Rgl1	UTSW	1	152521363	missense	probably benign
Z1088:Rgl1	UTSW	1	152675020	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- AGTCAATGAATGGGGAGCCC -3'
(R):5'- GGAACTCAGTAAATCCTCTTCTCATC -3'

Sequencing Primer
(F):5'- GAGCCCCCACATTGCAGAG -3'
(R):5'- GCCTTGGTTGGATTTTCTAACAAC -3'

Posted On

2020-06-30