Incidental Mutation 'R8140:Tnr'
ID 632461
Institutional Source Beutler Lab
Gene Symbol Tnr
Ensembl Gene ENSMUSG00000015829
Gene Name tenascin R
Synonyms TN-R, janusin, restrictin, J1-tenascin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8140 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 159523769-159931729 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 159863695 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 472 (T472A)
Ref Sequence ENSEMBL: ENSMUSP00000141553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111669] [ENSMUST00000192069]
AlphaFold Q8BYI9
Predicted Effect probably damaging
Transcript: ENSMUST00000111669
AA Change: T472A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107298
Gene: ENSMUSG00000015829
AA Change: T472A

DomainStartEndE-ValueType
EGF_like 203 231 3.87e1 SMART
EGF_like 234 262 3.16e1 SMART
EGF_like 265 293 2.8e1 SMART
EGF 296 324 2.43e1 SMART
FN3 326 404 4.77e-8 SMART
FN3 415 493 3.1e-7 SMART
FN3 504 583 2.01e-6 SMART
FN3 594 675 1.98e-5 SMART
FN3 686 763 3.29e-11 SMART
FN3 774 851 3.32e-7 SMART
FN3 864 942 3.73e-10 SMART
FN3 953 1031 2.28e-5 SMART
FN3 1041 1118 8.56e-10 SMART
FBG 1133 1343 2.69e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192069
AA Change: T472A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141553
Gene: ENSMUSG00000015829
AA Change: T472A

DomainStartEndE-ValueType
EGF_like 203 231 3.87e1 SMART
EGF_like 234 262 3.16e1 SMART
EGF_like 265 293 2.8e1 SMART
EGF 296 324 2.43e1 SMART
FN3 326 404 4.77e-8 SMART
FN3 415 493 3.1e-7 SMART
FN3 504 583 2.01e-6 SMART
FN3 594 675 1.98e-5 SMART
FN3 686 763 3.29e-11 SMART
FN3 774 851 3.32e-7 SMART
FN3 864 942 3.73e-10 SMART
FN3 953 1031 2.28e-5 SMART
FN3 1041 1118 8.56e-10 SMART
FBG 1133 1343 2.69e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192457
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tenascin family of extracellular matrix glycoproteins. The encoded protein is restricted to the central nervous system. The protein may play a role in neurite outgrowth, neural cell adhesion and modulation of sodium channel function. It is a constituent of perineuronal nets. [provided by RefSeq, Aug 2013]
PHENOTYPE: In spite of having decreased conduction velocity in the optic nerve and ultrastrucural alterations within the hippocampus, homozygous null mice are viable, fertile, and display normal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,611 V230E possibly damaging Het
Amotl1 G A 9: 14,572,715 probably null Het
Atp7b C A 8: 22,028,560 E87D probably damaging Het
Bcat2 C T 7: 45,588,351 P347L probably damaging Het
Brox A T 1: 183,293,873 probably null Het
Cd37 A G 7: 45,238,535 I58T probably damaging Het
Cep295 A T 9: 15,341,533 M333K probably benign Het
Chtop A G 3: 90,505,393 probably null Het
Cpa2 A T 6: 30,544,905 K54N probably benign Het
Cpa6 A G 1: 10,325,294 S383P probably damaging Het
Dnah7a A T 1: 53,501,589 I2542N probably benign Het
Eif5b G A 1: 38,051,276 V1179I probably benign Het
Erbin T C 13: 103,920,294 probably null Het
Fastkd5 A T 2: 130,615,250 D473E possibly damaging Het
Fchsd1 T C 18: 37,964,342 E372G probably damaging Het
Fgl1 T C 8: 41,200,609 probably null Het
Fzd8 T G 18: 9,213,797 V293G probably damaging Het
Gm4787 T A 12: 81,378,151 H411L probably benign Het
Gm49380 G T 9: 44,111,972 D326E probably benign Het
Hcrtr1 G A 4: 130,135,290 R240C probably damaging Het
Hdac5 A T 11: 102,197,355 Y948N probably damaging Het
Hepacam A G 9: 37,383,871 S301G probably benign Het
Htra4 A T 8: 25,030,558 D362E possibly damaging Het
Ighv1-9 G A 12: 114,583,741 P60L probably damaging Het
Kcnq3 A G 15: 65,995,541 I751T probably damaging Het
Magi3 T C 3: 104,034,086 Y851C probably damaging Het
Mefv A G 16: 3,713,635 S470P probably benign Het
Mfsd2a C T 4: 122,949,298 V397I probably benign Het
Mroh1 C A 15: 76,433,873 H867N probably benign Het
Mthfd1l C T 10: 4,007,745 R261* probably null Het
Myo3a A G 2: 22,407,346 I725M probably damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nek11 G T 9: 105,392,957 P22Q probably damaging Het
Olfr1179 T C 2: 88,402,113 T274A possibly damaging Het
Olfr1497 A T 19: 13,795,239 V124E possibly damaging Het
Olfr178 T C 16: 58,889,585 T212A probably benign Het
Peg10 C G 6: 4,756,113 Q230E unknown Het
Pipox T C 11: 77,883,909 D116G probably benign Het
Pkd1l2 C T 8: 117,047,497 R993H probably benign Het
Pkdrej A C 15: 85,818,410 N1108K probably damaging Het
Polr2a C T 11: 69,746,376 R291Q probably benign Het
Pomt1 T A 2: 32,244,297 Y277N probably damaging Het
Rasal2 A G 1: 157,299,235 S78P probably damaging Het
Rgl1 A T 1: 152,557,501 L171Q probably damaging Het
Sfta2 A G 17: 35,601,774 E14G unknown Het
Sh3rf3 T A 10: 59,049,355 S353R possibly damaging Het
Slc37a1 A T 17: 31,322,259 I242F probably damaging Het
Srfbp1 T A 18: 52,488,690 D274E probably damaging Het
Syne2 T A 12: 75,912,353 S685R possibly damaging Het
Tenm4 A C 7: 96,895,176 D2170A probably damaging Het
Tspan9 T C 6: 127,965,278 H203R probably damaging Het
Ttn T C 2: 76,771,651 T18556A possibly damaging Het
Usp25 T A 16: 77,071,681 Y323* probably null Het
Usp31 G T 7: 121,649,026 R1065S possibly damaging Het
Vmn2r103 A T 17: 19,811,796 T611S probably damaging Het
Wdfy4 A G 14: 33,142,360 V552A Het
Zap70 G T 1: 36,771,181 R124L possibly damaging Het
Zfand6 A T 7: 84,632,749 S91T possibly damaging Het
Other mutations in Tnr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Tnr APN 1 159861245 missense probably benign 0.00
IGL00905:Tnr APN 1 159852182 missense probably benign 0.06
IGL01396:Tnr APN 1 159897024 missense possibly damaging 0.91
IGL01550:Tnr APN 1 159874258 missense probably benign
IGL01803:Tnr APN 1 159868243 missense probably damaging 1.00
IGL01845:Tnr APN 1 159868006 unclassified probably benign
IGL01983:Tnr APN 1 159863779 missense probably benign 0.00
IGL01985:Tnr APN 1 159919037 missense possibly damaging 0.70
IGL02210:Tnr APN 1 159852101 missense probably benign 0.44
IGL02486:Tnr APN 1 159852094 splice site probably null
IGL03210:Tnr APN 1 159888310 missense probably benign 0.00
Assiduous UTSW 1 159892023 missense probably benign
Persistent UTSW 1 159852286 missense probably benign
Tenacious UTSW 1 159874200 missense probably damaging 1.00
R0002:Tnr UTSW 1 159874200 missense probably damaging 1.00
R0002:Tnr UTSW 1 159874200 missense probably damaging 1.00
R0009:Tnr UTSW 1 159852416 missense probably damaging 1.00
R0042:Tnr UTSW 1 159887025 missense probably benign 0.01
R0594:Tnr UTSW 1 159850335 missense probably benign
R0617:Tnr UTSW 1 159868103 missense probably damaging 1.00
R0637:Tnr UTSW 1 159850335 missense possibly damaging 0.60
R0682:Tnr UTSW 1 159852307 nonsense probably null
R1171:Tnr UTSW 1 159858210 missense probably damaging 0.97
R1185:Tnr UTSW 1 159852286 missense probably benign
R1185:Tnr UTSW 1 159852286 missense probably benign
R1185:Tnr UTSW 1 159852286 missense probably benign
R1335:Tnr UTSW 1 159868030 missense probably benign 0.18
R1540:Tnr UTSW 1 159850105 missense probably damaging 0.99
R1697:Tnr UTSW 1 159852030 missense probably benign 0.00
R1938:Tnr UTSW 1 159895037 nonsense probably null
R1941:Tnr UTSW 1 159850134 missense possibly damaging 0.92
R2021:Tnr UTSW 1 159852022 missense probably benign
R2022:Tnr UTSW 1 159852022 missense probably benign
R2051:Tnr UTSW 1 159892033 missense probably benign
R2157:Tnr UTSW 1 159858270 missense probably damaging 0.98
R2319:Tnr UTSW 1 159850048 start codon destroyed probably null 1.00
R2936:Tnr UTSW 1 159888362 missense probably damaging 0.96
R3015:Tnr UTSW 1 159888259 missense probably benign 0.00
R3417:Tnr UTSW 1 159895042 missense probably benign 0.00
R3739:Tnr UTSW 1 159923413 missense possibly damaging 0.78
R3977:Tnr UTSW 1 159892023 missense probably benign
R4232:Tnr UTSW 1 159886215 missense possibly damaging 0.55
R4478:Tnr UTSW 1 159884756 splice site probably null
R4774:Tnr UTSW 1 159897066 missense probably damaging 1.00
R4829:Tnr UTSW 1 159858404 missense probably benign 0.24
R4837:Tnr UTSW 1 159684788 intron probably benign
R5111:Tnr UTSW 1 159886228 missense probably benign 0.04
R5224:Tnr UTSW 1 159923315 missense probably damaging 1.00
R5249:Tnr UTSW 1 159684656 intron probably benign
R5730:Tnr UTSW 1 159888322 missense probably benign 0.02
R5807:Tnr UTSW 1 159886930 missense possibly damaging 0.95
R5832:Tnr UTSW 1 159886122 missense probably benign 0.15
R5927:Tnr UTSW 1 159912766 missense probably damaging 1.00
R6049:Tnr UTSW 1 159912754 missense probably damaging 1.00
R6056:Tnr UTSW 1 159886909 missense probably damaging 0.99
R6063:Tnr UTSW 1 159912684 missense probably benign 0.00
R6141:Tnr UTSW 1 159887122 missense probably benign
R6218:Tnr UTSW 1 159888314 missense possibly damaging 0.94
R6275:Tnr UTSW 1 159861270 missense probably damaging 0.99
R6543:Tnr UTSW 1 159924107 missense probably damaging 1.00
R6626:Tnr UTSW 1 159850252 missense probably damaging 1.00
R7378:Tnr UTSW 1 159884862 critical splice donor site probably null
R7587:Tnr UTSW 1 159886208 missense probably benign 0.27
R7766:Tnr UTSW 1 159888310 missense probably benign 0.00
R8215:Tnr UTSW 1 159888290 missense possibly damaging 0.91
R8248:Tnr UTSW 1 159892093 missense probably damaging 0.98
R8374:Tnr UTSW 1 159858383 missense probably benign 0.24
R8427:Tnr UTSW 1 159886231 missense possibly damaging 0.67
R8465:Tnr UTSW 1 159886075 missense probably benign 0.01
R8534:Tnr UTSW 1 159919015 missense probably benign 0.18
R8753:Tnr UTSW 1 159850366 missense probably benign 0.28
R8804:Tnr UTSW 1 159858312 missense probably benign
R8857:Tnr UTSW 1 159886158 missense probably benign 0.10
R8917:Tnr UTSW 1 159874122 nonsense probably null
R8930:Tnr UTSW 1 159912789 missense probably damaging 1.00
R8932:Tnr UTSW 1 159912789 missense probably damaging 1.00
R8940:Tnr UTSW 1 159858297 missense probably damaging 1.00
R9096:Tnr UTSW 1 159850234 missense probably benign 0.10
R9127:Tnr UTSW 1 159886110 missense possibly damaging 0.68
R9205:Tnr UTSW 1 159895047 missense probably benign
R9311:Tnr UTSW 1 159850093 missense probably benign 0.30
X0011:Tnr UTSW 1 159889338 missense probably benign 0.02
X0028:Tnr UTSW 1 159874114 missense probably damaging 1.00
Z1088:Tnr UTSW 1 159895095 missense probably benign 0.29
Z1177:Tnr UTSW 1 159852091 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCTGACAGTTCATGGGG -3'
(R):5'- CTGGCAGAGTATATCCATTTCCAAG -3'

Sequencing Primer
(F):5'- TTCATGGGGAACAGATGTAGTC -3'
(R):5'- AGAGTATATCCATTTCCAAGTCCCTG -3'
Posted On 2020-06-30