Incidental Mutation 'R8140:Pomt1'
ID 632463
Institutional Source Beutler Lab
Gene Symbol Pomt1
Ensembl Gene ENSMUSG00000039254
Gene Name protein-O-mannosyltransferase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock # R8140 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 32236590-32255005 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 32244297 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 277 (Y277N)
Ref Sequence ENSEMBL: ENSMUSP00000038722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036473] [ENSMUST00000123740] [ENSMUST00000146485]
AlphaFold Q8R2R1
Predicted Effect probably damaging
Transcript: ENSMUST00000036473
AA Change: Y277N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038722
Gene: ENSMUSG00000039254
AA Change: Y277N

DomainStartEndE-ValueType
Pfam:PMT 42 289 2.8e-96 PFAM
MIR 318 381 7.45e-8 SMART
MIR 392 449 1.65e-9 SMART
MIR 456 513 6.2e-5 SMART
Pfam:PMT_4TMC 542 740 3.9e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123740
SMART Domains Protein: ENSMUSP00000116543
Gene: ENSMUSG00000039254

DomainStartEndE-ValueType
Pfam:PMT 20 233 1.3e-84 PFAM
Pfam:PMT_2 64 229 3.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132516
Predicted Effect probably benign
Transcript: ENSMUST00000146485
SMART Domains Protein: ENSMUSP00000116117
Gene: ENSMUSG00000039254

DomainStartEndE-ValueType
Pfam:PMT 44 227 9e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192998
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an O-mannosyltransferase that requires interaction with the product of the POMT2 gene for enzymatic function. The encoded protein is found in the membrane of the endoplasmic reticulum. Defects in this gene are a cause of Walker-Warburg syndrome (WWS) and limb-girdle muscular dystrophy type 2K (LGMD2K). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene with one allele results in embryonic lethality with disruption of Reichert's membrane. Heterozygous mutation with a second allele results in ectasia in kidney and liver veins and an increased neutrophil count. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,611 V230E possibly damaging Het
Amotl1 G A 9: 14,572,715 probably null Het
Atp7b C A 8: 22,028,560 E87D probably damaging Het
Bcat2 C T 7: 45,588,351 P347L probably damaging Het
Brox A T 1: 183,293,873 probably null Het
Cd37 A G 7: 45,238,535 I58T probably damaging Het
Cep295 A T 9: 15,341,533 M333K probably benign Het
Chtop A G 3: 90,505,393 probably null Het
Cpa2 A T 6: 30,544,905 K54N probably benign Het
Cpa6 A G 1: 10,325,294 S383P probably damaging Het
Dnah7a A T 1: 53,501,589 I2542N probably benign Het
Eif5b G A 1: 38,051,276 V1179I probably benign Het
Erbin T C 13: 103,920,294 probably null Het
Fastkd5 A T 2: 130,615,250 D473E possibly damaging Het
Fchsd1 T C 18: 37,964,342 E372G probably damaging Het
Fgl1 T C 8: 41,200,609 probably null Het
Fzd8 T G 18: 9,213,797 V293G probably damaging Het
Gm4787 T A 12: 81,378,151 H411L probably benign Het
Gm49380 G T 9: 44,111,972 D326E probably benign Het
Hcrtr1 G A 4: 130,135,290 R240C probably damaging Het
Hdac5 A T 11: 102,197,355 Y948N probably damaging Het
Hepacam A G 9: 37,383,871 S301G probably benign Het
Htra4 A T 8: 25,030,558 D362E possibly damaging Het
Ighv1-9 G A 12: 114,583,741 P60L probably damaging Het
Kcnq3 A G 15: 65,995,541 I751T probably damaging Het
Magi3 T C 3: 104,034,086 Y851C probably damaging Het
Mefv A G 16: 3,713,635 S470P probably benign Het
Mfsd2a C T 4: 122,949,298 V397I probably benign Het
Mroh1 C A 15: 76,433,873 H867N probably benign Het
Mthfd1l C T 10: 4,007,745 R261* probably null Het
Myo3a A G 2: 22,407,346 I725M probably damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nek11 G T 9: 105,392,957 P22Q probably damaging Het
Olfr1179 T C 2: 88,402,113 T274A possibly damaging Het
Olfr1497 A T 19: 13,795,239 V124E possibly damaging Het
Olfr178 T C 16: 58,889,585 T212A probably benign Het
Peg10 C G 6: 4,756,113 Q230E unknown Het
Pipox T C 11: 77,883,909 D116G probably benign Het
Pkd1l2 C T 8: 117,047,497 R993H probably benign Het
Pkdrej A C 15: 85,818,410 N1108K probably damaging Het
Polr2a C T 11: 69,746,376 R291Q probably benign Het
Rasal2 A G 1: 157,299,235 S78P probably damaging Het
Rgl1 A T 1: 152,557,501 L171Q probably damaging Het
Sfta2 A G 17: 35,601,774 E14G unknown Het
Sh3rf3 T A 10: 59,049,355 S353R possibly damaging Het
Slc37a1 A T 17: 31,322,259 I242F probably damaging Het
Srfbp1 T A 18: 52,488,690 D274E probably damaging Het
Syne2 T A 12: 75,912,353 S685R possibly damaging Het
Tenm4 A C 7: 96,895,176 D2170A probably damaging Het
Tnr A G 1: 159,863,695 T472A probably damaging Het
Tspan9 T C 6: 127,965,278 H203R probably damaging Het
Ttn T C 2: 76,771,651 T18556A possibly damaging Het
Usp25 T A 16: 77,071,681 Y323* probably null Het
Usp31 G T 7: 121,649,026 R1065S possibly damaging Het
Vmn2r103 A T 17: 19,811,796 T611S probably damaging Het
Wdfy4 A G 14: 33,142,360 V552A Het
Zap70 G T 1: 36,771,181 R124L possibly damaging Het
Zfand6 A T 7: 84,632,749 S91T possibly damaging Het
Other mutations in Pomt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Pomt1 APN 2 32241772 missense probably benign
IGL01926:Pomt1 APN 2 32243472 missense probably benign 0.23
IGL02237:Pomt1 APN 2 32245677 missense probably benign 0.18
IGL02281:Pomt1 APN 2 32248646 missense possibly damaging 0.95
IGL03001:Pomt1 APN 2 32244326 missense probably benign
IGL03216:Pomt1 APN 2 32242943 missense probably damaging 0.99
IGL03343:Pomt1 APN 2 32253712 splice site probably benign
R0049:Pomt1 UTSW 2 32252011 missense possibly damaging 0.88
R0049:Pomt1 UTSW 2 32252011 missense possibly damaging 0.88
R0975:Pomt1 UTSW 2 32253895 critical splice donor site probably null
R1199:Pomt1 UTSW 2 32250492 missense probably benign
R1414:Pomt1 UTSW 2 32243610 splice site probably benign
R1421:Pomt1 UTSW 2 32236753 unclassified probably benign
R1806:Pomt1 UTSW 2 32241668 missense probably damaging 1.00
R2173:Pomt1 UTSW 2 32250900 missense probably damaging 1.00
R2209:Pomt1 UTSW 2 32250862 missense possibly damaging 0.90
R2302:Pomt1 UTSW 2 32243659 missense probably benign 0.00
R3084:Pomt1 UTSW 2 32244240 missense probably benign 0.02
R3774:Pomt1 UTSW 2 32244250 missense possibly damaging 0.93
R3933:Pomt1 UTSW 2 32245619 missense probably benign 0.00
R4177:Pomt1 UTSW 2 32248677 missense probably damaging 0.99
R4626:Pomt1 UTSW 2 32254412 missense possibly damaging 0.84
R4645:Pomt1 UTSW 2 32242876 intron probably benign
R4864:Pomt1 UTSW 2 32251992 missense probably benign 0.02
R4911:Pomt1 UTSW 2 32241679 missense probably damaging 0.97
R5143:Pomt1 UTSW 2 32254329 missense probably benign 0.23
R5288:Pomt1 UTSW 2 32244299 nonsense probably null
R5385:Pomt1 UTSW 2 32244299 nonsense probably null
R5718:Pomt1 UTSW 2 32248692 missense possibly damaging 0.91
R5735:Pomt1 UTSW 2 32243505 missense probably damaging 1.00
R5754:Pomt1 UTSW 2 32247590 missense probably damaging 0.99
R5817:Pomt1 UTSW 2 32248679 missense probably damaging 0.97
R6304:Pomt1 UTSW 2 32250790 missense probably damaging 1.00
R6477:Pomt1 UTSW 2 32248716 splice site probably null
R6793:Pomt1 UTSW 2 32242949 missense probably damaging 1.00
R6918:Pomt1 UTSW 2 32252861 splice site probably null
R7114:Pomt1 UTSW 2 32253836 missense probably benign 0.41
R8380:Pomt1 UTSW 2 32245607 missense probably damaging 1.00
R9082:Pomt1 UTSW 2 32252961 missense probably damaging 0.98
Z1177:Pomt1 UTSW 2 32237089 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCTAGCAGCATCTACCTGGG -3'
(R):5'- AAAGTCTCGAGATGGAGCCC -3'

Sequencing Primer
(F):5'- ATCTACCTGGGACAAAGGGCTTC -3'
(R):5'- TAGCTGCCCTGCCCCAC -3'
Posted On 2020-06-30