Incidental Mutation 'R8140:Olfr1179'
ID 632466
Institutional Source Beutler Lab
Gene Symbol Olfr1179
Ensembl Gene ENSMUSG00000075127
Gene Name olfactory receptor 1179
Synonyms MOR225-2, GA_x6K02T2Q125-49890854-49889931
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R8140 (G1)
Quality Score 124.008
Status Validated
Chromosome 2
Chromosomal Location 88401859-88406453 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88402113 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 274 (T274A)
Ref Sequence ENSEMBL: ENSMUSP00000151174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099825] [ENSMUST00000213157] [ENSMUST00000214040]
AlphaFold A2AUS6
Predicted Effect possibly damaging
Transcript: ENSMUST00000099825
AA Change: T274A

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097413
Gene: ENSMUSG00000075127
AA Change: T274A

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.1e-47 PFAM
Pfam:7tm_1 39 285 3e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213157
AA Change: T274A

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000214040
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,611 V230E possibly damaging Het
Amotl1 G A 9: 14,572,715 probably null Het
Atp7b C A 8: 22,028,560 E87D probably damaging Het
Bcat2 C T 7: 45,588,351 P347L probably damaging Het
Brox A T 1: 183,293,873 probably null Het
Cd37 A G 7: 45,238,535 I58T probably damaging Het
Cep295 A T 9: 15,341,533 M333K probably benign Het
Chtop A G 3: 90,505,393 probably null Het
Cpa2 A T 6: 30,544,905 K54N probably benign Het
Cpa6 A G 1: 10,325,294 S383P probably damaging Het
Dnah7a A T 1: 53,501,589 I2542N probably benign Het
Eif5b G A 1: 38,051,276 V1179I probably benign Het
Erbin T C 13: 103,920,294 probably null Het
Fastkd5 A T 2: 130,615,250 D473E possibly damaging Het
Fchsd1 T C 18: 37,964,342 E372G probably damaging Het
Fgl1 T C 8: 41,200,609 probably null Het
Fzd8 T G 18: 9,213,797 V293G probably damaging Het
Gm4787 T A 12: 81,378,151 H411L probably benign Het
Gm49380 G T 9: 44,111,972 D326E probably benign Het
Hcrtr1 G A 4: 130,135,290 R240C probably damaging Het
Hdac5 A T 11: 102,197,355 Y948N probably damaging Het
Hepacam A G 9: 37,383,871 S301G probably benign Het
Htra4 A T 8: 25,030,558 D362E possibly damaging Het
Ighv1-9 G A 12: 114,583,741 P60L probably damaging Het
Kcnq3 A G 15: 65,995,541 I751T probably damaging Het
Magi3 T C 3: 104,034,086 Y851C probably damaging Het
Mefv A G 16: 3,713,635 S470P probably benign Het
Mfsd2a C T 4: 122,949,298 V397I probably benign Het
Mroh1 C A 15: 76,433,873 H867N probably benign Het
Mthfd1l C T 10: 4,007,745 R261* probably null Het
Myo3a A G 2: 22,407,346 I725M probably damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nek11 G T 9: 105,392,957 P22Q probably damaging Het
Olfr1497 A T 19: 13,795,239 V124E possibly damaging Het
Olfr178 T C 16: 58,889,585 T212A probably benign Het
Peg10 C G 6: 4,756,113 Q230E unknown Het
Pipox T C 11: 77,883,909 D116G probably benign Het
Pkd1l2 C T 8: 117,047,497 R993H probably benign Het
Pkdrej A C 15: 85,818,410 N1108K probably damaging Het
Polr2a C T 11: 69,746,376 R291Q probably benign Het
Pomt1 T A 2: 32,244,297 Y277N probably damaging Het
Rasal2 A G 1: 157,299,235 S78P probably damaging Het
Rgl1 A T 1: 152,557,501 L171Q probably damaging Het
Sfta2 A G 17: 35,601,774 E14G unknown Het
Sh3rf3 T A 10: 59,049,355 S353R possibly damaging Het
Slc37a1 A T 17: 31,322,259 I242F probably damaging Het
Srfbp1 T A 18: 52,488,690 D274E probably damaging Het
Syne2 T A 12: 75,912,353 S685R possibly damaging Het
Tenm4 A C 7: 96,895,176 D2170A probably damaging Het
Tnr A G 1: 159,863,695 T472A probably damaging Het
Tspan9 T C 6: 127,965,278 H203R probably damaging Het
Ttn T C 2: 76,771,651 T18556A possibly damaging Het
Usp25 T A 16: 77,071,681 Y323* probably null Het
Usp31 G T 7: 121,649,026 R1065S possibly damaging Het
Vmn2r103 A T 17: 19,811,796 T611S probably damaging Het
Wdfy4 A G 14: 33,142,360 V552A Het
Zap70 G T 1: 36,771,181 R124L possibly damaging Het
Zfand6 A T 7: 84,632,749 S91T possibly damaging Het
Other mutations in Olfr1179
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Olfr1179 APN 2 88402077 missense possibly damaging 0.95
IGL02445:Olfr1179 APN 2 88402112 missense possibly damaging 0.60
R0127:Olfr1179 UTSW 2 88402355 missense probably benign 0.05
R0604:Olfr1179 UTSW 2 88402383 missense probably benign 0.03
R1526:Olfr1179 UTSW 2 88402433 missense probably damaging 1.00
R1816:Olfr1179 UTSW 2 88402599 missense possibly damaging 0.65
R2041:Olfr1179 UTSW 2 88402224 missense probably damaging 1.00
R3694:Olfr1179 UTSW 2 88402196 missense possibly damaging 0.80
R4229:Olfr1179 UTSW 2 88402883 missense possibly damaging 0.67
R4735:Olfr1179 UTSW 2 88402923 missense probably benign 0.02
R4974:Olfr1179 UTSW 2 88402412 missense probably damaging 1.00
R5173:Olfr1179 UTSW 2 88402922 missense probably benign 0.00
R5909:Olfr1179 UTSW 2 88402191 missense probably damaging 0.98
R6931:Olfr1179 UTSW 2 88402064 missense probably benign 0.01
R6990:Olfr1179 UTSW 2 88402295 missense probably benign 0.13
R7167:Olfr1179 UTSW 2 88402208 missense possibly damaging 0.46
R8121:Olfr1179 UTSW 2 88402696 missense probably benign
R8269:Olfr1179 UTSW 2 88402037 missense probably damaging 0.98
R8832:Olfr1179 UTSW 2 88402793 missense probably damaging 0.98
R9269:Olfr1179 UTSW 2 88402242 missense probably benign 0.06
Z1176:Olfr1179 UTSW 2 88402122 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGATGTAGGAAGACAAACATCCC -3'
(R):5'- TTCAGGCATGATGGGACTGG -3'

Sequencing Primer
(F):5'- TAGGAAGACAAACATCCCATTTTAGC -3'
(R):5'- CATGATGGGACTGGTCACCTTC -3'
Posted On 2020-06-30