Incidental Mutation 'R8140:Chtop'
ID 632468
Institutional Source Beutler Lab
Gene Symbol Chtop
Ensembl Gene ENSMUSG00000001017
Gene Name chromatin target of PRMT1
Synonyms friend of Prmt1, 2500003M10Rik, Fop
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8140 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 90498956-90509498 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 90505393 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001043] [ENSMUST00000049937] [ENSMUST00000076639] [ENSMUST00000107342] [ENSMUST00000107343] [ENSMUST00000107344] [ENSMUST00000107346] [ENSMUST00000131868] [ENSMUST00000146740]
AlphaFold Q9CY57
Predicted Effect probably benign
Transcript: ENSMUST00000001043
SMART Domains Protein: ENSMUSP00000001043
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 62 84 N/A INTRINSIC
low complexity region 86 106 N/A INTRINSIC
FoP_duplication 133 221 3.35e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049937
SMART Domains Protein: ENSMUSP00000061800
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
low complexity region 69 83 N/A INTRINSIC
low complexity region 87 109 N/A INTRINSIC
low complexity region 111 131 N/A INTRINSIC
FoP_duplication 158 246 3.35e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076639
SMART Domains Protein: ENSMUSP00000075936
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
Blast:FoP_duplication 59 84 3e-6 BLAST
low complexity region 86 108 N/A INTRINSIC
FoP_duplication 114 199 1.21e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107342
SMART Domains Protein: ENSMUSP00000102965
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Blast:FoP_duplication 34 59 3e-6 BLAST
low complexity region 61 83 N/A INTRINSIC
FoP_duplication 89 174 1.21e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107343
SMART Domains Protein: ENSMUSP00000102966
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 62 84 N/A INTRINSIC
FoP_duplication 90 175 1.21e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107344
SMART Domains Protein: ENSMUSP00000102967
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 62 84 N/A INTRINSIC
low complexity region 86 106 N/A INTRINSIC
FoP_duplication 133 221 3.35e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107346
SMART Domains Protein: ENSMUSP00000102969
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
low complexity region 69 83 N/A INTRINSIC
low complexity region 87 109 N/A INTRINSIC
FoP_duplication 115 200 1.21e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131868
SMART Domains Protein: ENSMUSP00000123448
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
low complexity region 69 83 N/A INTRINSIC
low complexity region 87 109 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000146740
SMART Domains Protein: ENSMUSP00000116945
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 139 159 N/A INTRINSIC
low complexity region 177 195 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,611 V230E possibly damaging Het
Amotl1 G A 9: 14,572,715 probably null Het
Atp7b C A 8: 22,028,560 E87D probably damaging Het
Bcat2 C T 7: 45,588,351 P347L probably damaging Het
Brox A T 1: 183,293,873 probably null Het
Cd37 A G 7: 45,238,535 I58T probably damaging Het
Cep295 A T 9: 15,341,533 M333K probably benign Het
Cpa2 A T 6: 30,544,905 K54N probably benign Het
Cpa6 A G 1: 10,325,294 S383P probably damaging Het
Dnah7a A T 1: 53,501,589 I2542N probably benign Het
Eif5b G A 1: 38,051,276 V1179I probably benign Het
Erbin T C 13: 103,920,294 probably null Het
Fastkd5 A T 2: 130,615,250 D473E possibly damaging Het
Fchsd1 T C 18: 37,964,342 E372G probably damaging Het
Fgl1 T C 8: 41,200,609 probably null Het
Fzd8 T G 18: 9,213,797 V293G probably damaging Het
Gm4787 T A 12: 81,378,151 H411L probably benign Het
Gm49380 G T 9: 44,111,972 D326E probably benign Het
Hcrtr1 G A 4: 130,135,290 R240C probably damaging Het
Hdac5 A T 11: 102,197,355 Y948N probably damaging Het
Hepacam A G 9: 37,383,871 S301G probably benign Het
Htra4 A T 8: 25,030,558 D362E possibly damaging Het
Ighv1-9 G A 12: 114,583,741 P60L probably damaging Het
Kcnq3 A G 15: 65,995,541 I751T probably damaging Het
Magi3 T C 3: 104,034,086 Y851C probably damaging Het
Mefv A G 16: 3,713,635 S470P probably benign Het
Mfsd2a C T 4: 122,949,298 V397I probably benign Het
Mroh1 C A 15: 76,433,873 H867N probably benign Het
Mthfd1l C T 10: 4,007,745 R261* probably null Het
Myo3a A G 2: 22,407,346 I725M probably damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nek11 G T 9: 105,392,957 P22Q probably damaging Het
Olfr1179 T C 2: 88,402,113 T274A possibly damaging Het
Olfr1497 A T 19: 13,795,239 V124E possibly damaging Het
Olfr178 T C 16: 58,889,585 T212A probably benign Het
Peg10 C G 6: 4,756,113 Q230E unknown Het
Pipox T C 11: 77,883,909 D116G probably benign Het
Pkd1l2 C T 8: 117,047,497 R993H probably benign Het
Pkdrej A C 15: 85,818,410 N1108K probably damaging Het
Polr2a C T 11: 69,746,376 R291Q probably benign Het
Pomt1 T A 2: 32,244,297 Y277N probably damaging Het
Rasal2 A G 1: 157,299,235 S78P probably damaging Het
Rgl1 A T 1: 152,557,501 L171Q probably damaging Het
Sfta2 A G 17: 35,601,774 E14G unknown Het
Sh3rf3 T A 10: 59,049,355 S353R possibly damaging Het
Slc37a1 A T 17: 31,322,259 I242F probably damaging Het
Srfbp1 T A 18: 52,488,690 D274E probably damaging Het
Syne2 T A 12: 75,912,353 S685R possibly damaging Het
Tenm4 A C 7: 96,895,176 D2170A probably damaging Het
Tnr A G 1: 159,863,695 T472A probably damaging Het
Tspan9 T C 6: 127,965,278 H203R probably damaging Het
Ttn T C 2: 76,771,651 T18556A possibly damaging Het
Usp25 T A 16: 77,071,681 Y323* probably null Het
Usp31 G T 7: 121,649,026 R1065S possibly damaging Het
Vmn2r103 A T 17: 19,811,796 T611S probably damaging Het
Wdfy4 A G 14: 33,142,360 V552A Het
Zap70 G T 1: 36,771,181 R124L possibly damaging Het
Zfand6 A T 7: 84,632,749 S91T possibly damaging Het
Other mutations in Chtop
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02739:Chtop APN 3 90502250 missense possibly damaging 0.69
IGL02979:Chtop APN 3 90500095 missense probably benign 0.04
R1672:Chtop UTSW 3 90507567 missense probably damaging 0.99
R2163:Chtop UTSW 3 90502211 missense probably benign 0.02
R5728:Chtop UTSW 3 90500092 missense probably damaging 1.00
R5734:Chtop UTSW 3 90502115 critical splice donor site probably null
R7082:Chtop UTSW 3 90507584 missense probably benign
R7936:Chtop UTSW 3 90507351 intron probably benign
Predicted Primers PCR Primer
(F):5'- TTGGAAAATGTGGGCCTACGG -3'
(R):5'- GTTCATTAGCATAGCAGAACAAGC -3'

Sequencing Primer
(F):5'- CTACGGCTTGTTGTTCTCCTGAG -3'
(R):5'- TTAGCATAGCAGAACAAGCATATAG -3'
Posted On 2020-06-30