Incidental Mutation 'R8140:Magi3'
ID 632469
Institutional Source Beutler Lab
Gene Symbol Magi3
Ensembl Gene ENSMUSG00000052539
Gene Name membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms 4732496O19Rik, 6530407C02Rik
MMRRC Submission 067568-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.435) question?
Stock # R8140 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 103920575-104127690 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103941402 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 851 (Y851C)
Ref Sequence ENSEMBL: ENSMUSP00000067932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064371] [ENSMUST00000121198] [ENSMUST00000122303]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000064371
AA Change: Y851C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000067932
Gene: ENSMUSG00000052539
AA Change: Y851C

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121198
AA Change: Y851C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112934
Gene: ENSMUSG00000052539
AA Change: Y851C

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122303
AA Change: Y851C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113713
Gene: ENSMUSG00000052539
AA Change: Y851C

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 64,055,954 (GRCm39) V230E possibly damaging Het
Amotl1 G A 9: 14,484,011 (GRCm39) probably null Het
Atp7b C A 8: 22,518,576 (GRCm39) E87D probably damaging Het
Bcat2 C T 7: 45,237,775 (GRCm39) P347L probably damaging Het
Brox A T 1: 183,075,437 (GRCm39) probably null Het
Cd37 A G 7: 44,887,959 (GRCm39) I58T probably damaging Het
Cep295 A T 9: 15,252,829 (GRCm39) M333K probably benign Het
Chtop A G 3: 90,412,700 (GRCm39) probably null Het
Cpa2 A T 6: 30,544,904 (GRCm39) K54N probably benign Het
Cpa6 A G 1: 10,395,519 (GRCm39) S383P probably damaging Het
Dnah7a A T 1: 53,540,748 (GRCm39) I2542N probably benign Het
Eif5b G A 1: 38,090,357 (GRCm39) V1179I probably benign Het
Erbin T C 13: 104,056,802 (GRCm39) probably null Het
Fastkd5 A T 2: 130,457,170 (GRCm39) D473E possibly damaging Het
Fchsd1 T C 18: 38,097,395 (GRCm39) E372G probably damaging Het
Fgl1 T C 8: 41,653,646 (GRCm39) probably null Het
Fzd8 T G 18: 9,213,797 (GRCm39) V293G probably damaging Het
Gm4787 T A 12: 81,424,925 (GRCm39) H411L probably benign Het
Gm49380 G T 9: 44,023,269 (GRCm39) D326E probably benign Het
Hcrtr1 G A 4: 130,029,083 (GRCm39) R240C probably damaging Het
Hdac5 A T 11: 102,088,181 (GRCm39) Y948N probably damaging Het
Hepacam A G 9: 37,295,167 (GRCm39) S301G probably benign Het
Htra4 A T 8: 25,520,574 (GRCm39) D362E possibly damaging Het
Ighv1-9 G A 12: 114,547,361 (GRCm39) P60L probably damaging Het
Kcnq3 A G 15: 65,867,390 (GRCm39) I751T probably damaging Het
Mefv A G 16: 3,531,499 (GRCm39) S470P probably benign Het
Mfsd2a C T 4: 122,843,091 (GRCm39) V397I probably benign Het
Mroh1 C A 15: 76,318,073 (GRCm39) H867N probably benign Het
Mthfd1l C T 10: 3,957,745 (GRCm39) R261* probably null Het
Myo3a A G 2: 22,412,157 (GRCm39) I725M probably damaging Het
Neb T C 2: 52,099,552 (GRCm39) D4766G possibly damaging Het
Nek11 G T 9: 105,270,156 (GRCm39) P22Q probably damaging Het
Or4p18 T C 2: 88,232,457 (GRCm39) T274A possibly damaging Het
Or5k15 T C 16: 58,709,948 (GRCm39) T212A probably benign Het
Or9q2 A T 19: 13,772,603 (GRCm39) V124E possibly damaging Het
Peg10 C G 6: 4,756,113 (GRCm39) Q230E unknown Het
Pipox T C 11: 77,774,735 (GRCm39) D116G probably benign Het
Pkd1l2 C T 8: 117,774,236 (GRCm39) R993H probably benign Het
Pkdrej A C 15: 85,702,611 (GRCm39) N1108K probably damaging Het
Polr2a C T 11: 69,637,202 (GRCm39) R291Q probably benign Het
Pomt1 T A 2: 32,134,309 (GRCm39) Y277N probably damaging Het
Rasal2 A G 1: 157,126,805 (GRCm39) S78P probably damaging Het
Rgl1 A T 1: 152,433,252 (GRCm39) L171Q probably damaging Het
Sfta2 A G 17: 35,912,666 (GRCm39) E14G unknown Het
Sh3rf3 T A 10: 58,885,177 (GRCm39) S353R possibly damaging Het
Slc37a1 A T 17: 31,541,233 (GRCm39) I242F probably damaging Het
Srfbp1 T A 18: 52,621,762 (GRCm39) D274E probably damaging Het
Syne2 T A 12: 75,959,127 (GRCm39) S685R possibly damaging Het
Tenm4 A C 7: 96,544,383 (GRCm39) D2170A probably damaging Het
Tnr A G 1: 159,691,265 (GRCm39) T472A probably damaging Het
Tspan9 T C 6: 127,942,241 (GRCm39) H203R probably damaging Het
Ttn T C 2: 76,601,995 (GRCm39) T18556A possibly damaging Het
Usp25 T A 16: 76,868,569 (GRCm39) Y323* probably null Het
Usp31 G T 7: 121,248,249 (GRCm39) R1065S possibly damaging Het
Vmn2r103 A T 17: 20,032,058 (GRCm39) T611S probably damaging Het
Wdfy4 A G 14: 32,864,317 (GRCm39) V552A Het
Zap70 G T 1: 36,810,262 (GRCm39) R124L possibly damaging Het
Zfand6 A T 7: 84,281,957 (GRCm39) S91T possibly damaging Het
Other mutations in Magi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Magi3 APN 3 103,922,294 (GRCm39) missense probably damaging 1.00
IGL00933:Magi3 APN 3 103,923,163 (GRCm39) missense probably benign
IGL01151:Magi3 APN 3 103,958,690 (GRCm39) missense probably damaging 1.00
IGL01674:Magi3 APN 3 104,013,037 (GRCm39) splice site probably benign
IGL01790:Magi3 APN 3 103,992,560 (GRCm39) missense probably damaging 1.00
IGL01903:Magi3 APN 3 103,958,526 (GRCm39) missense possibly damaging 0.87
IGL01939:Magi3 APN 3 103,961,778 (GRCm39) missense probably damaging 0.99
IGL02142:Magi3 APN 3 103,923,219 (GRCm39) missense probably benign 0.32
IGL02183:Magi3 APN 3 103,992,663 (GRCm39) missense probably benign 0.01
IGL02887:Magi3 APN 3 104,002,473 (GRCm39) missense probably damaging 1.00
IGL03071:Magi3 APN 3 103,923,202 (GRCm39) missense possibly damaging 0.51
IGL03085:Magi3 APN 3 103,922,655 (GRCm39) missense possibly damaging 0.88
IGL03192:Magi3 APN 3 103,950,562 (GRCm39) missense probably damaging 1.00
IGL03204:Magi3 APN 3 104,013,151 (GRCm39) missense probably damaging 1.00
IGL03227:Magi3 APN 3 103,958,435 (GRCm39) missense probably benign
IGL03388:Magi3 APN 3 103,923,157 (GRCm39) missense probably benign 0.30
PIT4280001:Magi3 UTSW 3 103,961,668 (GRCm39) missense probably damaging 1.00
PIT4504001:Magi3 UTSW 3 103,922,842 (GRCm39) missense probably benign 0.05
R0092:Magi3 UTSW 3 103,958,280 (GRCm39) nonsense probably null
R0514:Magi3 UTSW 3 103,922,338 (GRCm39) missense probably damaging 1.00
R0569:Magi3 UTSW 3 103,923,358 (GRCm39) missense probably benign 0.43
R0608:Magi3 UTSW 3 103,924,873 (GRCm39) missense probably damaging 1.00
R0920:Magi3 UTSW 3 103,941,507 (GRCm39) splice site probably null
R1173:Magi3 UTSW 3 103,968,946 (GRCm39) critical splice donor site probably null
R1256:Magi3 UTSW 3 103,935,126 (GRCm39) missense probably benign 0.08
R1391:Magi3 UTSW 3 103,922,374 (GRCm39) nonsense probably null
R1559:Magi3 UTSW 3 103,954,169 (GRCm39) splice site probably benign
R1568:Magi3 UTSW 3 103,996,843 (GRCm39) missense probably benign 0.02
R1631:Magi3 UTSW 3 103,958,493 (GRCm39) missense probably benign 0.05
R1747:Magi3 UTSW 3 103,941,489 (GRCm39) missense possibly damaging 0.82
R1930:Magi3 UTSW 3 103,996,920 (GRCm39) missense probably damaging 1.00
R1964:Magi3 UTSW 3 103,927,718 (GRCm39) missense probably damaging 0.99
R2151:Magi3 UTSW 3 103,992,554 (GRCm39) missense probably damaging 1.00
R2151:Magi3 UTSW 3 103,954,198 (GRCm39) missense probably damaging 1.00
R2266:Magi3 UTSW 3 103,928,382 (GRCm39) intron probably benign
R2267:Magi3 UTSW 3 103,928,382 (GRCm39) intron probably benign
R2268:Magi3 UTSW 3 103,928,382 (GRCm39) intron probably benign
R2519:Magi3 UTSW 3 103,923,081 (GRCm39) missense probably benign 0.00
R3104:Magi3 UTSW 3 103,958,636 (GRCm39) missense probably damaging 0.99
R3105:Magi3 UTSW 3 103,958,636 (GRCm39) missense probably damaging 0.99
R3619:Magi3 UTSW 3 103,961,721 (GRCm39) missense probably damaging 1.00
R4158:Magi3 UTSW 3 103,958,277 (GRCm39) missense probably damaging 1.00
R4160:Magi3 UTSW 3 103,958,277 (GRCm39) missense probably damaging 1.00
R4284:Magi3 UTSW 3 103,923,184 (GRCm39) nonsense probably null
R4285:Magi3 UTSW 3 103,923,184 (GRCm39) nonsense probably null
R4397:Magi3 UTSW 3 104,127,030 (GRCm39) missense probably damaging 1.00
R4512:Magi3 UTSW 3 103,996,871 (GRCm39) missense probably damaging 0.99
R4676:Magi3 UTSW 3 103,923,141 (GRCm39) missense probably benign
R4758:Magi3 UTSW 3 103,922,637 (GRCm39) missense probably benign 0.01
R4940:Magi3 UTSW 3 103,958,708 (GRCm39) missense probably damaging 1.00
R5039:Magi3 UTSW 3 104,013,107 (GRCm39) missense probably damaging 1.00
R5160:Magi3 UTSW 3 103,935,224 (GRCm39) missense possibly damaging 0.46
R5422:Magi3 UTSW 3 103,958,684 (GRCm39) missense probably damaging 1.00
R5509:Magi3 UTSW 3 103,922,818 (GRCm39) missense probably benign 0.00
R5839:Magi3 UTSW 3 104,127,047 (GRCm39) missense probably damaging 1.00
R5924:Magi3 UTSW 3 103,961,854 (GRCm39) splice site probably null
R6018:Magi3 UTSW 3 104,013,128 (GRCm39) missense probably damaging 1.00
R6189:Magi3 UTSW 3 103,958,181 (GRCm39) missense probably damaging 1.00
R6235:Magi3 UTSW 3 103,923,384 (GRCm39) missense probably damaging 0.99
R6244:Magi3 UTSW 3 103,923,013 (GRCm39) missense probably benign 0.16
R6258:Magi3 UTSW 3 103,996,912 (GRCm39) missense probably damaging 1.00
R6358:Magi3 UTSW 3 103,958,268 (GRCm39) missense probably damaging 1.00
R6534:Magi3 UTSW 3 103,992,536 (GRCm39) missense possibly damaging 0.75
R6806:Magi3 UTSW 3 103,954,285 (GRCm39) missense possibly damaging 0.94
R6816:Magi3 UTSW 3 103,997,227 (GRCm39) splice site probably null
R6897:Magi3 UTSW 3 103,996,873 (GRCm39) missense probably damaging 1.00
R7011:Magi3 UTSW 3 104,013,070 (GRCm39) missense probably damaging 1.00
R7039:Magi3 UTSW 3 103,958,699 (GRCm39) missense probably damaging 1.00
R7196:Magi3 UTSW 3 103,956,484 (GRCm39) missense probably benign 0.01
R7237:Magi3 UTSW 3 103,935,227 (GRCm39) missense probably damaging 1.00
R7285:Magi3 UTSW 3 103,941,430 (GRCm39) missense probably benign 0.00
R7709:Magi3 UTSW 3 103,941,354 (GRCm39) missense probably damaging 1.00
R7724:Magi3 UTSW 3 103,923,243 (GRCm39) missense probably benign 0.04
R7797:Magi3 UTSW 3 103,958,618 (GRCm39) missense probably damaging 1.00
R7950:Magi3 UTSW 3 103,924,005 (GRCm39) missense probably damaging 1.00
R8204:Magi3 UTSW 3 103,958,502 (GRCm39) missense probably benign
R8229:Magi3 UTSW 3 103,923,018 (GRCm39) missense probably benign 0.00
R8229:Magi3 UTSW 3 103,923,017 (GRCm39) missense possibly damaging 0.79
R8260:Magi3 UTSW 3 103,922,625 (GRCm39) missense probably benign 0.01
R8348:Magi3 UTSW 3 103,958,531 (GRCm39) missense probably damaging 1.00
R8368:Magi3 UTSW 3 104,002,379 (GRCm39) critical splice donor site probably null
R8543:Magi3 UTSW 3 104,126,984 (GRCm39) missense probably damaging 0.98
R8762:Magi3 UTSW 3 103,958,169 (GRCm39) missense probably damaging 1.00
R8826:Magi3 UTSW 3 103,992,662 (GRCm39) missense probably benign 0.00
R8847:Magi3 UTSW 3 103,922,334 (GRCm39) missense probably benign 0.09
R8892:Magi3 UTSW 3 103,958,141 (GRCm39) missense probably damaging 1.00
R8939:Magi3 UTSW 3 103,996,748 (GRCm39) intron probably benign
R9090:Magi3 UTSW 3 103,923,264 (GRCm39) missense possibly damaging 0.68
R9187:Magi3 UTSW 3 103,923,073 (GRCm39) missense possibly damaging 0.76
R9271:Magi3 UTSW 3 103,923,264 (GRCm39) missense possibly damaging 0.68
R9433:Magi3 UTSW 3 103,922,473 (GRCm39) missense probably benign 0.01
R9439:Magi3 UTSW 3 103,922,473 (GRCm39) missense probably benign 0.01
R9557:Magi3 UTSW 3 103,924,933 (GRCm39) missense probably damaging 1.00
R9557:Magi3 UTSW 3 103,922,473 (GRCm39) missense probably benign 0.01
R9697:Magi3 UTSW 3 103,956,458 (GRCm39) critical splice donor site probably null
R9796:Magi3 UTSW 3 103,928,291 (GRCm39) missense probably benign
X0026:Magi3 UTSW 3 103,927,736 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGAGCTGAAAGGTTTAGATTGTC -3'
(R):5'- GGGGCAGCATGCTACATTTC -3'

Sequencing Primer
(F):5'- CCAGAAAACCGGGTGTT -3'
(R):5'- GGGGCAGCATGCTACATTTCTATTC -3'
Posted On 2020-06-30