Incidental Mutation 'R8140:Mfsd2a'
ID 632470
Institutional Source Beutler Lab
Gene Symbol Mfsd2a
Ensembl Gene ENSMUSG00000028655
Gene Name major facilitator superfamily domain containing 2A
Synonyms 1700018O18Rik, Mfsd2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock # R8140 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 122946850-122961188 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 122949298 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 397 (V397I)
Ref Sequence ENSEMBL: ENSMUSP00000030408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030408]
AlphaFold Q9DA75
Predicted Effect probably benign
Transcript: ENSMUST00000030408
AA Change: V397I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030408
Gene: ENSMUSG00000028655
AA Change: V397I

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 27 39 N/A INTRINSIC
Pfam:MFS_2 44 500 1.7e-96 PFAM
Pfam:MFS_1 57 450 9.3e-12 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show partial postnatal lethality, reduced body weight, ataxia, and alterations in lipid metabolism and photoreceptor cell development. Homozygotes for a different null allele show a leaky blood-brain barrier and increased CNS-endothelial-cell vesicular transcytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,611 V230E possibly damaging Het
Amotl1 G A 9: 14,572,715 probably null Het
Atp7b C A 8: 22,028,560 E87D probably damaging Het
Bcat2 C T 7: 45,588,351 P347L probably damaging Het
Brox A T 1: 183,293,873 probably null Het
Cd37 A G 7: 45,238,535 I58T probably damaging Het
Cep295 A T 9: 15,341,533 M333K probably benign Het
Chtop A G 3: 90,505,393 probably null Het
Cpa2 A T 6: 30,544,905 K54N probably benign Het
Cpa6 A G 1: 10,325,294 S383P probably damaging Het
Dnah7a A T 1: 53,501,589 I2542N probably benign Het
Eif5b G A 1: 38,051,276 V1179I probably benign Het
Erbin T C 13: 103,920,294 probably null Het
Fastkd5 A T 2: 130,615,250 D473E possibly damaging Het
Fchsd1 T C 18: 37,964,342 E372G probably damaging Het
Fgl1 T C 8: 41,200,609 probably null Het
Fzd8 T G 18: 9,213,797 V293G probably damaging Het
Gm4787 T A 12: 81,378,151 H411L probably benign Het
Gm49380 G T 9: 44,111,972 D326E probably benign Het
Hcrtr1 G A 4: 130,135,290 R240C probably damaging Het
Hdac5 A T 11: 102,197,355 Y948N probably damaging Het
Hepacam A G 9: 37,383,871 S301G probably benign Het
Htra4 A T 8: 25,030,558 D362E possibly damaging Het
Ighv1-9 G A 12: 114,583,741 P60L probably damaging Het
Kcnq3 A G 15: 65,995,541 I751T probably damaging Het
Magi3 T C 3: 104,034,086 Y851C probably damaging Het
Mefv A G 16: 3,713,635 S470P probably benign Het
Mroh1 C A 15: 76,433,873 H867N probably benign Het
Mthfd1l C T 10: 4,007,745 R261* probably null Het
Myo3a A G 2: 22,407,346 I725M probably damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nek11 G T 9: 105,392,957 P22Q probably damaging Het
Olfr1179 T C 2: 88,402,113 T274A possibly damaging Het
Olfr1497 A T 19: 13,795,239 V124E possibly damaging Het
Olfr178 T C 16: 58,889,585 T212A probably benign Het
Peg10 C G 6: 4,756,113 Q230E unknown Het
Pipox T C 11: 77,883,909 D116G probably benign Het
Pkd1l2 C T 8: 117,047,497 R993H probably benign Het
Pkdrej A C 15: 85,818,410 N1108K probably damaging Het
Polr2a C T 11: 69,746,376 R291Q probably benign Het
Pomt1 T A 2: 32,244,297 Y277N probably damaging Het
Rasal2 A G 1: 157,299,235 S78P probably damaging Het
Rgl1 A T 1: 152,557,501 L171Q probably damaging Het
Sfta2 A G 17: 35,601,774 E14G unknown Het
Sh3rf3 T A 10: 59,049,355 S353R possibly damaging Het
Slc37a1 A T 17: 31,322,259 I242F probably damaging Het
Srfbp1 T A 18: 52,488,690 D274E probably damaging Het
Syne2 T A 12: 75,912,353 S685R possibly damaging Het
Tenm4 A C 7: 96,895,176 D2170A probably damaging Het
Tnr A G 1: 159,863,695 T472A probably damaging Het
Tspan9 T C 6: 127,965,278 H203R probably damaging Het
Ttn T C 2: 76,771,651 T18556A possibly damaging Het
Usp25 T A 16: 77,071,681 Y323* probably null Het
Usp31 G T 7: 121,649,026 R1065S possibly damaging Het
Vmn2r103 A T 17: 19,811,796 T611S probably damaging Het
Wdfy4 A G 14: 33,142,360 V552A Het
Zap70 G T 1: 36,771,181 R124L possibly damaging Het
Zfand6 A T 7: 84,632,749 S91T possibly damaging Het
Other mutations in Mfsd2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Mfsd2a APN 4 122949307 missense probably benign 0.32
IGL02756:Mfsd2a APN 4 122948539 missense probably benign 0.30
azure UTSW 4 122952021 missense possibly damaging 0.66
R0355:Mfsd2a UTSW 4 122951839 missense possibly damaging 0.64
R0394:Mfsd2a UTSW 4 122950168 missense probably benign 0.26
R2002:Mfsd2a UTSW 4 122956816 missense probably damaging 1.00
R2516:Mfsd2a UTSW 4 122950487 missense probably damaging 1.00
R2943:Mfsd2a UTSW 4 122948589 missense possibly damaging 0.87
R3052:Mfsd2a UTSW 4 122951842 missense probably damaging 1.00
R4811:Mfsd2a UTSW 4 122959382 missense probably benign 0.28
R4977:Mfsd2a UTSW 4 122950509 missense probably benign
R5030:Mfsd2a UTSW 4 122950156 missense possibly damaging 0.90
R5231:Mfsd2a UTSW 4 122959301 missense possibly damaging 0.88
R5735:Mfsd2a UTSW 4 122949327 missense probably damaging 0.98
R6173:Mfsd2a UTSW 4 122951246 missense probably benign
R6321:Mfsd2a UTSW 4 122949372 missense probably benign 0.06
R6433:Mfsd2a UTSW 4 122950457 missense probably benign 0.01
R6736:Mfsd2a UTSW 4 122951261 missense probably benign
R6793:Mfsd2a UTSW 4 122950705 missense probably benign 0.02
R7073:Mfsd2a UTSW 4 122951295 missense possibly damaging 0.91
R7255:Mfsd2a UTSW 4 122952021 missense possibly damaging 0.66
R7382:Mfsd2a UTSW 4 122952123 missense possibly damaging 0.53
R7868:Mfsd2a UTSW 4 122956855 missense possibly damaging 0.93
R8095:Mfsd2a UTSW 4 122951271 missense probably damaging 1.00
R8136:Mfsd2a UTSW 4 122951867 missense probably benign 0.27
R8832:Mfsd2a UTSW 4 122949309 missense probably benign 0.01
R8842:Mfsd2a UTSW 4 122951830 missense probably damaging 0.98
R9048:Mfsd2a UTSW 4 122960975 missense probably benign
R9084:Mfsd2a UTSW 4 122950201 missense probably damaging 1.00
Z1176:Mfsd2a UTSW 4 122951839 missense probably benign 0.44
Z1176:Mfsd2a UTSW 4 122959311 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TAGACATTCTGCTTGGCAAAGAG -3'
(R):5'- ACATCGGGATCTCTGTGAGTG -3'

Sequencing Primer
(F):5'- TCTGCTTGGCAAAGAGAGGGC -3'
(R):5'- GTGGCTCAAAGGGCAGAGTTG -3'
Posted On 2020-06-30