Incidental Mutation 'R8140:0610040J01Rik'
ID 632472
Institutional Source Beutler Lab
Gene Symbol 0610040J01Rik
Ensembl Gene ENSMUSG00000060512
Gene Name RIKEN cDNA 0610040J01 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock # R8140 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 63812363-63899625 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 63898611 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 230 (V230E)
Ref Sequence ENSEMBL: ENSMUSP00000080443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081747] [ENSMUST00000196367] [ENSMUST00000196575] [ENSMUST00000199667]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000081747
AA Change: V230E

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080443
Gene: ENSMUSG00000060512
AA Change: V230E

DomainStartEndE-ValueType
Pfam:DUF4699 9 313 2.5e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196367
Predicted Effect probably benign
Transcript: ENSMUST00000196575
Predicted Effect probably benign
Transcript: ENSMUST00000199667
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl1 G A 9: 14,572,715 probably null Het
Atp7b C A 8: 22,028,560 E87D probably damaging Het
Bcat2 C T 7: 45,588,351 P347L probably damaging Het
Brox A T 1: 183,293,873 probably null Het
Cd37 A G 7: 45,238,535 I58T probably damaging Het
Cep295 A T 9: 15,341,533 M333K probably benign Het
Chtop A G 3: 90,505,393 probably null Het
Cpa2 A T 6: 30,544,905 K54N probably benign Het
Cpa6 A G 1: 10,325,294 S383P probably damaging Het
Dnah7a A T 1: 53,501,589 I2542N probably benign Het
Eif5b G A 1: 38,051,276 V1179I probably benign Het
Erbin T C 13: 103,920,294 probably null Het
Fastkd5 A T 2: 130,615,250 D473E possibly damaging Het
Fchsd1 T C 18: 37,964,342 E372G probably damaging Het
Fgl1 T C 8: 41,200,609 probably null Het
Fzd8 T G 18: 9,213,797 V293G probably damaging Het
Gm4787 T A 12: 81,378,151 H411L probably benign Het
Gm49380 G T 9: 44,111,972 D326E probably benign Het
Hcrtr1 G A 4: 130,135,290 R240C probably damaging Het
Hdac5 A T 11: 102,197,355 Y948N probably damaging Het
Hepacam A G 9: 37,383,871 S301G probably benign Het
Htra4 A T 8: 25,030,558 D362E possibly damaging Het
Ighv1-9 G A 12: 114,583,741 P60L probably damaging Het
Kcnq3 A G 15: 65,995,541 I751T probably damaging Het
Magi3 T C 3: 104,034,086 Y851C probably damaging Het
Mefv A G 16: 3,713,635 S470P probably benign Het
Mfsd2a C T 4: 122,949,298 V397I probably benign Het
Mroh1 C A 15: 76,433,873 H867N probably benign Het
Mthfd1l C T 10: 4,007,745 R261* probably null Het
Myo3a A G 2: 22,407,346 I725M probably damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nek11 G T 9: 105,392,957 P22Q probably damaging Het
Olfr1179 T C 2: 88,402,113 T274A possibly damaging Het
Olfr1497 A T 19: 13,795,239 V124E possibly damaging Het
Olfr178 T C 16: 58,889,585 T212A probably benign Het
Peg10 C G 6: 4,756,113 Q230E unknown Het
Pipox T C 11: 77,883,909 D116G probably benign Het
Pkd1l2 C T 8: 117,047,497 R993H probably benign Het
Pkdrej A C 15: 85,818,410 N1108K probably damaging Het
Polr2a C T 11: 69,746,376 R291Q probably benign Het
Pomt1 T A 2: 32,244,297 Y277N probably damaging Het
Rasal2 A G 1: 157,299,235 S78P probably damaging Het
Rgl1 A T 1: 152,557,501 L171Q probably damaging Het
Sfta2 A G 17: 35,601,774 E14G unknown Het
Sh3rf3 T A 10: 59,049,355 S353R possibly damaging Het
Slc37a1 A T 17: 31,322,259 I242F probably damaging Het
Srfbp1 T A 18: 52,488,690 D274E probably damaging Het
Syne2 T A 12: 75,912,353 S685R possibly damaging Het
Tenm4 A C 7: 96,895,176 D2170A probably damaging Het
Tnr A G 1: 159,863,695 T472A probably damaging Het
Tspan9 T C 6: 127,965,278 H203R probably damaging Het
Ttn T C 2: 76,771,651 T18556A possibly damaging Het
Usp25 T A 16: 77,071,681 Y323* probably null Het
Usp31 G T 7: 121,649,026 R1065S possibly damaging Het
Vmn2r103 A T 17: 19,811,796 T611S probably damaging Het
Wdfy4 A G 14: 33,142,360 V552A Het
Zap70 G T 1: 36,771,181 R124L possibly damaging Het
Zfand6 A T 7: 84,632,749 S91T possibly damaging Het
Other mutations in 0610040J01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:0610040J01Rik APN 5 63898383 missense possibly damaging 0.79
IGL02229:0610040J01Rik APN 5 63898353 missense probably damaging 0.99
IGL02389:0610040J01Rik APN 5 63896483 missense probably null 1.00
IGL02411:0610040J01Rik APN 5 63898116 missense probably benign 0.31
R0243:0610040J01Rik UTSW 5 63898463 missense probably benign 0.10
R0411:0610040J01Rik UTSW 5 63896491 splice site probably benign
R1978:0610040J01Rik UTSW 5 63898537 nonsense probably null
R2072:0610040J01Rik UTSW 5 63898737 missense possibly damaging 0.83
R2202:0610040J01Rik UTSW 5 63898668 missense possibly damaging 0.91
R3161:0610040J01Rik UTSW 5 63896490 splice site probably benign
R3162:0610040J01Rik UTSW 5 63896490 splice site probably benign
R4428:0610040J01Rik UTSW 5 63898839 unclassified probably benign
R4429:0610040J01Rik UTSW 5 63898839 unclassified probably benign
R4430:0610040J01Rik UTSW 5 63898839 unclassified probably benign
R4431:0610040J01Rik UTSW 5 63898839 unclassified probably benign
R4464:0610040J01Rik UTSW 5 63898839 unclassified probably benign
R4465:0610040J01Rik UTSW 5 63898839 unclassified probably benign
R4467:0610040J01Rik UTSW 5 63898839 unclassified probably benign
R4491:0610040J01Rik UTSW 5 63898469 missense probably damaging 1.00
R5161:0610040J01Rik UTSW 5 63898001 nonsense probably null
R6115:0610040J01Rik UTSW 5 63897974 missense probably damaging 1.00
R6273:0610040J01Rik UTSW 5 63898218 missense probably damaging 1.00
R7445:0610040J01Rik UTSW 5 63898619 missense probably damaging 0.99
R7593:0610040J01Rik UTSW 5 63898431 missense probably damaging 0.97
R8070:0610040J01Rik UTSW 5 63898167 missense probably benign 0.01
R8165:0610040J01Rik UTSW 5 63897946 splice site probably null
R8557:0610040J01Rik UTSW 5 63898611 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGGCAGTGGCAGATCACATC -3'
(R):5'- GTAGGCACATGCTTCTATCTGC -3'

Sequencing Primer
(F):5'- GTGGCAGATCACATCCCATAC -3'
(R):5'- GCAGCTTCTAATGCTGCGAG -3'
Posted On 2020-06-30