Incidental Mutation 'R8140:Peg10'
ID 632473
Institutional Source Beutler Lab
Gene Symbol Peg10
Ensembl Gene ENSMUSG00000092035
Gene Name paternally expressed 10
Synonyms MEF3L, MyEF-3 like, Rtl2, Mar2, MyEF-3, HB-1, Edr, Mart2
MMRRC Submission 067568-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8140 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 4747306-4760517 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 4756113 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 230 (Q230E)
Ref Sequence ENSEMBL: ENSMUSP00000135076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166678] [ENSMUST00000176204] [ENSMUST00000176551]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000166678
AA Change: Q631E
SMART Domains Protein: ENSMUSP00000127306
Gene: ENSMUSG00000092035
AA Change: Q631E

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:DUF4939 130 220 6.1e-17 PFAM
Pfam:Retrotrans_gag 174 267 2.9e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
low complexity region 368 379 N/A INTRINSIC
low complexity region 541 610 N/A INTRINSIC
low complexity region 621 660 N/A INTRINSIC
low complexity region 663 785 N/A INTRINSIC
Blast:SERPIN 798 910 1e-5 BLAST
low complexity region 923 936 N/A INTRINSIC
low complexity region 972 998 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176204
SMART Domains Protein: ENSMUSP00000134963
Gene: ENSMUSG00000092035

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
Pfam:Retrotrans_gag 174 267 1.3e-20 PFAM
low complexity region 334 342 N/A INTRINSIC
ZnF_C2HC 345 361 3.34e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000176551
AA Change: Q230E
SMART Domains Protein: ENSMUSP00000135076
Gene: ENSMUSG00000092035
AA Change: Q230E

DomainStartEndE-ValueType
low complexity region 173 242 N/A INTRINSIC
low complexity region 253 292 N/A INTRINSIC
low complexity region 295 417 N/A INTRINSIC
Blast:SERPIN 430 542 6e-6 BLAST
low complexity region 555 568 N/A INTRINSIC
low complexity region 604 630 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: This is a paternally expressed imprinted gene that is thought to have been derived from the Ty3/Gypsy family of retrotransposons. It contains two overlapping open reading frames, RF1 and RF2, and expresses two proteins: a shorter, gag-like protein (with a CCHC-type zinc finger domain) from RF1; and a longer, gag/pol-like fusion protein (with an additional aspartic protease motif) from RF1/RF2 by -1 translational frameshifting (-1 FS). While -1 FS has been observed in RNA viruses and transposons in both prokaryotes and eukaryotes, this gene represents the first example of -1 FS in a eukaryotic cellular gene. This gene is highly conserved across mammalian species and retains the heptanucleotide (GGGAAAC) and pseudoknot elements required for -1 FS. It is expressed in adult and embryonic tissues (most notably in placenta) and reported to have a role in cell proliferation, differentiation, apoptosis and cancer development. Knockout mice lacking this gene showed early embryonic lethality with placental defects, indicating the importance of this gene in embryonic development. [provided by RefSeq, Oct 2014]
PHENOTYPE: Heterozygous mice with a paternally inherited null allele display embryonic lethality during organogenesis with abnormal placental development. Heterozygous mice with a maternally inherited null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 64,055,954 (GRCm39) V230E possibly damaging Het
Amotl1 G A 9: 14,484,011 (GRCm39) probably null Het
Atp7b C A 8: 22,518,576 (GRCm39) E87D probably damaging Het
Bcat2 C T 7: 45,237,775 (GRCm39) P347L probably damaging Het
Brox A T 1: 183,075,437 (GRCm39) probably null Het
Cd37 A G 7: 44,887,959 (GRCm39) I58T probably damaging Het
Cep295 A T 9: 15,252,829 (GRCm39) M333K probably benign Het
Chtop A G 3: 90,412,700 (GRCm39) probably null Het
Cpa2 A T 6: 30,544,904 (GRCm39) K54N probably benign Het
Cpa6 A G 1: 10,395,519 (GRCm39) S383P probably damaging Het
Dnah7a A T 1: 53,540,748 (GRCm39) I2542N probably benign Het
Eif5b G A 1: 38,090,357 (GRCm39) V1179I probably benign Het
Erbin T C 13: 104,056,802 (GRCm39) probably null Het
Fastkd5 A T 2: 130,457,170 (GRCm39) D473E possibly damaging Het
Fchsd1 T C 18: 38,097,395 (GRCm39) E372G probably damaging Het
Fgl1 T C 8: 41,653,646 (GRCm39) probably null Het
Fzd8 T G 18: 9,213,797 (GRCm39) V293G probably damaging Het
Gm4787 T A 12: 81,424,925 (GRCm39) H411L probably benign Het
Gm49380 G T 9: 44,023,269 (GRCm39) D326E probably benign Het
Hcrtr1 G A 4: 130,029,083 (GRCm39) R240C probably damaging Het
Hdac5 A T 11: 102,088,181 (GRCm39) Y948N probably damaging Het
Hepacam A G 9: 37,295,167 (GRCm39) S301G probably benign Het
Htra4 A T 8: 25,520,574 (GRCm39) D362E possibly damaging Het
Ighv1-9 G A 12: 114,547,361 (GRCm39) P60L probably damaging Het
Kcnq3 A G 15: 65,867,390 (GRCm39) I751T probably damaging Het
Magi3 T C 3: 103,941,402 (GRCm39) Y851C probably damaging Het
Mefv A G 16: 3,531,499 (GRCm39) S470P probably benign Het
Mfsd2a C T 4: 122,843,091 (GRCm39) V397I probably benign Het
Mroh1 C A 15: 76,318,073 (GRCm39) H867N probably benign Het
Mthfd1l C T 10: 3,957,745 (GRCm39) R261* probably null Het
Myo3a A G 2: 22,412,157 (GRCm39) I725M probably damaging Het
Neb T C 2: 52,099,552 (GRCm39) D4766G possibly damaging Het
Nek11 G T 9: 105,270,156 (GRCm39) P22Q probably damaging Het
Or4p18 T C 2: 88,232,457 (GRCm39) T274A possibly damaging Het
Or5k15 T C 16: 58,709,948 (GRCm39) T212A probably benign Het
Or9q2 A T 19: 13,772,603 (GRCm39) V124E possibly damaging Het
Pipox T C 11: 77,774,735 (GRCm39) D116G probably benign Het
Pkd1l2 C T 8: 117,774,236 (GRCm39) R993H probably benign Het
Pkdrej A C 15: 85,702,611 (GRCm39) N1108K probably damaging Het
Polr2a C T 11: 69,637,202 (GRCm39) R291Q probably benign Het
Pomt1 T A 2: 32,134,309 (GRCm39) Y277N probably damaging Het
Rasal2 A G 1: 157,126,805 (GRCm39) S78P probably damaging Het
Rgl1 A T 1: 152,433,252 (GRCm39) L171Q probably damaging Het
Sfta2 A G 17: 35,912,666 (GRCm39) E14G unknown Het
Sh3rf3 T A 10: 58,885,177 (GRCm39) S353R possibly damaging Het
Slc37a1 A T 17: 31,541,233 (GRCm39) I242F probably damaging Het
Srfbp1 T A 18: 52,621,762 (GRCm39) D274E probably damaging Het
Syne2 T A 12: 75,959,127 (GRCm39) S685R possibly damaging Het
Tenm4 A C 7: 96,544,383 (GRCm39) D2170A probably damaging Het
Tnr A G 1: 159,691,265 (GRCm39) T472A probably damaging Het
Tspan9 T C 6: 127,942,241 (GRCm39) H203R probably damaging Het
Ttn T C 2: 76,601,995 (GRCm39) T18556A possibly damaging Het
Usp25 T A 16: 76,868,569 (GRCm39) Y323* probably null Het
Usp31 G T 7: 121,248,249 (GRCm39) R1065S possibly damaging Het
Vmn2r103 A T 17: 20,032,058 (GRCm39) T611S probably damaging Het
Wdfy4 A G 14: 32,864,317 (GRCm39) V552A Het
Zap70 G T 1: 36,810,262 (GRCm39) R124L possibly damaging Het
Zfand6 A T 7: 84,281,957 (GRCm39) S91T possibly damaging Het
Other mutations in Peg10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Peg10 APN 6 4,754,473 (GRCm39) utr 5 prime probably benign
IGL03063:Peg10 APN 6 4,756,647 (GRCm39) utr 3 prime probably benign
piaggio UTSW 6 4,756,427 (GRCm39) utr 3 prime probably benign
PIT4480001:Peg10 UTSW 6 4,756,560 (GRCm39) missense unknown
R0090:Peg10 UTSW 6 4,756,063 (GRCm39) utr 3 prime probably benign
R0148:Peg10 UTSW 6 4,755,711 (GRCm39) missense possibly damaging 0.88
R0650:Peg10 UTSW 6 4,756,475 (GRCm39) small insertion probably benign
R0698:Peg10 UTSW 6 4,756,835 (GRCm39) utr 3 prime probably benign
R1600:Peg10 UTSW 6 4,757,080 (GRCm39) utr 3 prime probably benign
R1842:Peg10 UTSW 6 4,756,381 (GRCm39) utr 3 prime probably benign
R1930:Peg10 UTSW 6 4,755,778 (GRCm39) missense probably damaging 0.99
R1931:Peg10 UTSW 6 4,755,778 (GRCm39) missense probably damaging 0.99
R2162:Peg10 UTSW 6 4,755,914 (GRCm39) utr 3 prime probably benign
R2215:Peg10 UTSW 6 4,756,918 (GRCm39) utr 3 prime probably benign
R2339:Peg10 UTSW 6 4,756,102 (GRCm39) utr 3 prime probably benign
R2847:Peg10 UTSW 6 4,756,912 (GRCm39) utr 3 prime probably benign
R2848:Peg10 UTSW 6 4,756,912 (GRCm39) utr 3 prime probably benign
R3000:Peg10 UTSW 6 4,754,276 (GRCm39) utr 5 prime probably benign
R3056:Peg10 UTSW 6 4,755,029 (GRCm39) missense possibly damaging 0.66
R4051:Peg10 UTSW 6 4,754,534 (GRCm39) missense probably benign 0.00
R4059:Peg10 UTSW 6 4,756,427 (GRCm39) utr 3 prime probably benign
R4296:Peg10 UTSW 6 4,756,472 (GRCm39) small insertion probably benign
R4626:Peg10 UTSW 6 4,756,460 (GRCm39) small insertion probably benign
R4634:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R4679:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R4834:Peg10 UTSW 6 4,754,294 (GRCm39) utr 5 prime probably benign
R4982:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R4983:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R4996:Peg10 UTSW 6 4,756,454 (GRCm39) small insertion probably benign
R4997:Peg10 UTSW 6 4,756,457 (GRCm39) small insertion probably benign
R5015:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R5085:Peg10 UTSW 6 4,755,864 (GRCm39) utr 3 prime probably benign
R5091:Peg10 UTSW 6 4,754,511 (GRCm39) missense probably benign 0.01
R5231:Peg10 UTSW 6 4,756,939 (GRCm39) utr 3 prime probably benign
R5278:Peg10 UTSW 6 4,756,442 (GRCm39) small deletion probably benign
R5364:Peg10 UTSW 6 4,756,128 (GRCm39) utr 3 prime probably benign
R5397:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R5485:Peg10 UTSW 6 4,755,565 (GRCm39) missense probably benign 0.09
R5573:Peg10 UTSW 6 4,755,913 (GRCm39) utr 3 prime probably benign
R5710:Peg10 UTSW 6 4,756,351 (GRCm39) small insertion probably benign
R5710:Peg10 UTSW 6 4,756,350 (GRCm39) small insertion probably benign
R5736:Peg10 UTSW 6 4,754,423 (GRCm39) missense probably benign 0.00
R5865:Peg10 UTSW 6 4,754,375 (GRCm39) missense probably damaging 0.98
R6056:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6116:Peg10 UTSW 6 4,756,351 (GRCm39) small insertion probably benign
R6129:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6147:Peg10 UTSW 6 4,754,499 (GRCm39) start gained probably benign
R6171:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6194:Peg10 UTSW 6 4,756,351 (GRCm39) small insertion probably benign
R6197:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6207:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6215:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6276:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6281:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6287:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6302:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6393:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6394:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6405:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R6421:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6486:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6538:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6668:Peg10 UTSW 6 4,754,502 (GRCm39) missense probably benign 0.01
R6679:Peg10 UTSW 6 4,754,276 (GRCm39) utr 5 prime probably benign
R6685:Peg10 UTSW 6 4,754,738 (GRCm39) missense probably damaging 1.00
R6702:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6706:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6747:Peg10 UTSW 6 4,757,137 (GRCm39) utr 3 prime probably benign
R6775:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6811:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6823:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R6826:Peg10 UTSW 6 4,756,353 (GRCm39) small insertion probably benign
R6847:Peg10 UTSW 6 4,754,279 (GRCm39) utr 5 prime probably benign
R6861:Peg10 UTSW 6 4,756,351 (GRCm39) small insertion probably benign
R6861:Peg10 UTSW 6 4,756,350 (GRCm39) small insertion probably benign
R6876:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6891:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R6911:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R6973:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R6990:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R6998:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7070:Peg10 UTSW 6 4,756,454 (GRCm39) small insertion probably benign
R7120:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7132:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7140:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7189:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R7208:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7256:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7260:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7261:Peg10 UTSW 6 4,756,591 (GRCm39) missense unknown
R7401:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7409:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7439:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R7475:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7483:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R7502:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7515:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7520:Peg10 UTSW 6 4,756,796 (GRCm39) missense unknown
R7544:Peg10 UTSW 6 4,756,427 (GRCm39) frame shift probably null
R7571:Peg10 UTSW 6 4,756,082 (GRCm39) missense unknown
R7581:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7635:Peg10 UTSW 6 4,754,938 (GRCm39) missense probably damaging 0.99
R7677:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7697:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R7710:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7803:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R7816:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R7820:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R7827:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7861:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R7881:Peg10 UTSW 6 4,756,454 (GRCm39) small insertion probably benign
R7904:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R7915:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R7916:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R7963:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8016:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8037:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8062:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8081:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8113:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8115:Peg10 UTSW 6 4,756,707 (GRCm39) missense unknown
R8178:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8233:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8239:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8281:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R8310:Peg10 UTSW 6 4,756,454 (GRCm39) small insertion probably benign
R8312:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8330:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8338:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8354:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8387:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8390:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8408:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8415:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8439:Peg10 UTSW 6 4,755,462 (GRCm39) missense possibly damaging 0.58
R8444:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8463:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8477:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8507:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R8552:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8678:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R8699:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8700:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8705:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8765:Peg10 UTSW 6 4,754,492 (GRCm39) missense unknown
R8824:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8859:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8870:Peg10 UTSW 6 4,754,825 (GRCm39) missense probably damaging 0.99
R8909:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R8918:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8924:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R8925:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8930:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R8950:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8960:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R8975:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R8988:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9046:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9068:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9074:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9088:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R9094:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R9114:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9116:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9135:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R9137:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9139:Peg10 UTSW 6 4,757,128 (GRCm39) missense unknown
R9139:Peg10 UTSW 6 4,756,449 (GRCm39) small insertion probably benign
R9171:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9173:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9213:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9216:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9229:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9233:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9283:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9328:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9367:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9369:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9405:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9410:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9412:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R9421:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9437:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9440:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9460:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9492:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9495:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9500:Peg10 UTSW 6 4,756,871 (GRCm39) missense unknown
R9511:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9515:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9576:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9610:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9611:Peg10 UTSW 6 4,756,453 (GRCm39) small insertion probably benign
R9611:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9614:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
R9619:Peg10 UTSW 6 4,755,316 (GRCm39) missense probably benign 0.02
R9646:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9655:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9673:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
R9675:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9696:Peg10 UTSW 6 4,756,431 (GRCm39) small deletion probably benign
R9749:Peg10 UTSW 6 4,756,398 (GRCm39) small deletion probably benign
R9756:Peg10 UTSW 6 4,756,452 (GRCm39) small insertion probably benign
X0065:Peg10 UTSW 6 4,756,515 (GRCm39) utr 3 prime probably benign
Z1176:Peg10 UTSW 6 4,756,451 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTTTACAGTGCCACAACCG -3'
(R):5'- TAGAAGAATGGTGGCTGCTG -3'

Sequencing Primer
(F):5'- GTTTACAGTGCCACAACCGAATTTG -3'
(R):5'- CATCCTGATGGGGATCCTGATGC -3'
Posted On 2020-06-30