Incidental Mutation 'R8140:Cd37'
ID 632476
Institutional Source Beutler Lab
Gene Symbol Cd37
Ensembl Gene ENSMUSG00000030798
Gene Name CD37 antigen
Synonyms Tspan26
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8140 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 45233632-45239115 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45238535 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 58 (I58T)
Ref Sequence ENSEMBL: ENSMUSP00000033063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033060] [ENSMUST00000033063] [ENSMUST00000097216] [ENSMUST00000098461] [ENSMUST00000107801] [ENSMUST00000209779] [ENSMUST00000210078] [ENSMUST00000210226] [ENSMUST00000210372] [ENSMUST00000211373] [ENSMUST00000213347]
AlphaFold Q61470
Predicted Effect probably benign
Transcript: ENSMUST00000033060
SMART Domains Protein: ENSMUSP00000033060
Gene: ENSMUSG00000030796

DomainStartEndE-ValueType
TEA 36 107 4.84e-52 SMART
low complexity region 201 217 N/A INTRINSIC
PDB:3L15|B 218 445 1e-143 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000033063
AA Change: I58T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033063
Gene: ENSMUSG00000030798
AA Change: I58T

DomainStartEndE-ValueType
Pfam:Tetraspannin 31 292 9.5e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097216
SMART Domains Protein: ENSMUSP00000103430
Gene: ENSMUSG00000030796

DomainStartEndE-ValueType
low complexity region 11 38 N/A INTRINSIC
Pfam:TEA 40 402 1.8e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098461
AA Change: I36T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096061
Gene: ENSMUSG00000030798
AA Change: I36T

DomainStartEndE-ValueType
Pfam:Tetraspannin 10 270 3.5e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107801
SMART Domains Protein: ENSMUSP00000103431
Gene: ENSMUSG00000030796

DomainStartEndE-ValueType
TEA 36 107 4.84e-52 SMART
low complexity region 201 217 N/A INTRINSIC
PDB:3L15|B 218 445 1e-143 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000209779
AA Change: I36T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000210078
AA Change: I33T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210226
Predicted Effect probably damaging
Transcript: ENSMUST00000210372
AA Change: I36T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000211373
AA Change: I36T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213347
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins and other transmembrane 4 superfamily proteins. It may play a role in T-cell-B-cell interactions. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced levels of IgG1 immunoglobulins and impaired antibody response to T cell dependent antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,611 V230E possibly damaging Het
Amotl1 G A 9: 14,572,715 probably null Het
Atp7b C A 8: 22,028,560 E87D probably damaging Het
Bcat2 C T 7: 45,588,351 P347L probably damaging Het
Brox A T 1: 183,293,873 probably null Het
Cep295 A T 9: 15,341,533 M333K probably benign Het
Chtop A G 3: 90,505,393 probably null Het
Cpa2 A T 6: 30,544,905 K54N probably benign Het
Cpa6 A G 1: 10,325,294 S383P probably damaging Het
Dnah7a A T 1: 53,501,589 I2542N probably benign Het
Eif5b G A 1: 38,051,276 V1179I probably benign Het
Erbin T C 13: 103,920,294 probably null Het
Fastkd5 A T 2: 130,615,250 D473E possibly damaging Het
Fchsd1 T C 18: 37,964,342 E372G probably damaging Het
Fgl1 T C 8: 41,200,609 probably null Het
Fzd8 T G 18: 9,213,797 V293G probably damaging Het
Gm4787 T A 12: 81,378,151 H411L probably benign Het
Gm49380 G T 9: 44,111,972 D326E probably benign Het
Hcrtr1 G A 4: 130,135,290 R240C probably damaging Het
Hdac5 A T 11: 102,197,355 Y948N probably damaging Het
Hepacam A G 9: 37,383,871 S301G probably benign Het
Htra4 A T 8: 25,030,558 D362E possibly damaging Het
Ighv1-9 G A 12: 114,583,741 P60L probably damaging Het
Kcnq3 A G 15: 65,995,541 I751T probably damaging Het
Magi3 T C 3: 104,034,086 Y851C probably damaging Het
Mefv A G 16: 3,713,635 S470P probably benign Het
Mfsd2a C T 4: 122,949,298 V397I probably benign Het
Mroh1 C A 15: 76,433,873 H867N probably benign Het
Mthfd1l C T 10: 4,007,745 R261* probably null Het
Myo3a A G 2: 22,407,346 I725M probably damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nek11 G T 9: 105,392,957 P22Q probably damaging Het
Olfr1179 T C 2: 88,402,113 T274A possibly damaging Het
Olfr1497 A T 19: 13,795,239 V124E possibly damaging Het
Olfr178 T C 16: 58,889,585 T212A probably benign Het
Peg10 C G 6: 4,756,113 Q230E unknown Het
Pipox T C 11: 77,883,909 D116G probably benign Het
Pkd1l2 C T 8: 117,047,497 R993H probably benign Het
Pkdrej A C 15: 85,818,410 N1108K probably damaging Het
Polr2a C T 11: 69,746,376 R291Q probably benign Het
Pomt1 T A 2: 32,244,297 Y277N probably damaging Het
Rasal2 A G 1: 157,299,235 S78P probably damaging Het
Rgl1 A T 1: 152,557,501 L171Q probably damaging Het
Sfta2 A G 17: 35,601,774 E14G unknown Het
Sh3rf3 T A 10: 59,049,355 S353R possibly damaging Het
Slc37a1 A T 17: 31,322,259 I242F probably damaging Het
Srfbp1 T A 18: 52,488,690 D274E probably damaging Het
Syne2 T A 12: 75,912,353 S685R possibly damaging Het
Tenm4 A C 7: 96,895,176 D2170A probably damaging Het
Tnr A G 1: 159,863,695 T472A probably damaging Het
Tspan9 T C 6: 127,965,278 H203R probably damaging Het
Ttn T C 2: 76,771,651 T18556A possibly damaging Het
Usp25 T A 16: 77,071,681 Y323* probably null Het
Usp31 G T 7: 121,649,026 R1065S possibly damaging Het
Vmn2r103 A T 17: 19,811,796 T611S probably damaging Het
Wdfy4 A G 14: 33,142,360 V552A Het
Zap70 G T 1: 36,771,181 R124L possibly damaging Het
Zfand6 A T 7: 84,632,749 S91T possibly damaging Het
Other mutations in Cd37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Cd37 APN 7 45236179 missense probably benign 0.01
IGL02703:Cd37 APN 7 45235525 missense probably benign 0.07
Blocker UTSW 7 45237174 missense probably damaging 0.98
R4888:Cd37 UTSW 7 45233935 missense probably damaging 0.99
R6197:Cd37 UTSW 7 45237174 missense probably damaging 0.98
R7048:Cd37 UTSW 7 45238464 unclassified probably benign
R8924:Cd37 UTSW 7 45238685 missense probably damaging 1.00
R9051:Cd37 UTSW 7 45237198 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCACACATCCAGCTTACTG -3'
(R):5'- ATGTCCGCCCAAGAGAGTTG -3'

Sequencing Primer
(F):5'- AGTGGGGTGCCAGTCAG -3'
(R):5'- GAGTTGCCTCAGCCTCATCAAG -3'
Posted On 2020-06-30