Incidental Mutation 'R8140:Bcat2'
ID 632477
Institutional Source Beutler Lab
Gene Symbol Bcat2
Ensembl Gene ENSMUSG00000030826
Gene Name branched chain aminotransferase 2, mitochondrial
Synonyms Eca40, Bcat-2
MMRRC Submission 067568-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.116) question?
Stock # R8140 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 45219773-45239134 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 45237775 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 347 (P347L)
Ref Sequence ENSEMBL: ENSMUSP00000033098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033098] [ENSMUST00000120864] [ENSMUST00000209204] [ENSMUST00000210811] [ENSMUST00000211173]
AlphaFold O35855
Predicted Effect probably damaging
Transcript: ENSMUST00000033098
AA Change: P347L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033098
Gene: ENSMUSG00000030826
AA Change: P347L

DomainStartEndE-ValueType
Pfam:Aminotran_4 101 351 5.4e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120864
AA Change: P342L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113045
Gene: ENSMUSG00000030826
AA Change: P342L

DomainStartEndE-ValueType
Pfam:Aminotran_4 119 370 7.6e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209204
AA Change: P307L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000209410
Predicted Effect probably benign
Transcript: ENSMUST00000210811
Predicted Effect probably damaging
Transcript: ENSMUST00000211173
AA Change: P307L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a branched chain aminotransferase found in mitochondria. The encoded protein forms a dimer that catalyzes the first step in the production of the branched chain amino acids leucine, isoleucine, and valine. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: The metabolism of branched chain amino acid is impaired in homozygous null mice, resulting in a phenotype similar to human maple syrup urine disease. Mutants exhibit a failure to thrive and die prematurely, though the severity of the symptoms can be ameliorated with a restricted diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 64,055,954 (GRCm39) V230E possibly damaging Het
Amotl1 G A 9: 14,484,011 (GRCm39) probably null Het
Atp7b C A 8: 22,518,576 (GRCm39) E87D probably damaging Het
Brox A T 1: 183,075,437 (GRCm39) probably null Het
Cd37 A G 7: 44,887,959 (GRCm39) I58T probably damaging Het
Cep295 A T 9: 15,252,829 (GRCm39) M333K probably benign Het
Chtop A G 3: 90,412,700 (GRCm39) probably null Het
Cpa2 A T 6: 30,544,904 (GRCm39) K54N probably benign Het
Cpa6 A G 1: 10,395,519 (GRCm39) S383P probably damaging Het
Dnah7a A T 1: 53,540,748 (GRCm39) I2542N probably benign Het
Eif5b G A 1: 38,090,357 (GRCm39) V1179I probably benign Het
Erbin T C 13: 104,056,802 (GRCm39) probably null Het
Fastkd5 A T 2: 130,457,170 (GRCm39) D473E possibly damaging Het
Fchsd1 T C 18: 38,097,395 (GRCm39) E372G probably damaging Het
Fgl1 T C 8: 41,653,646 (GRCm39) probably null Het
Fzd8 T G 18: 9,213,797 (GRCm39) V293G probably damaging Het
Gm4787 T A 12: 81,424,925 (GRCm39) H411L probably benign Het
Gm49380 G T 9: 44,023,269 (GRCm39) D326E probably benign Het
Hcrtr1 G A 4: 130,029,083 (GRCm39) R240C probably damaging Het
Hdac5 A T 11: 102,088,181 (GRCm39) Y948N probably damaging Het
Hepacam A G 9: 37,295,167 (GRCm39) S301G probably benign Het
Htra4 A T 8: 25,520,574 (GRCm39) D362E possibly damaging Het
Ighv1-9 G A 12: 114,547,361 (GRCm39) P60L probably damaging Het
Kcnq3 A G 15: 65,867,390 (GRCm39) I751T probably damaging Het
Magi3 T C 3: 103,941,402 (GRCm39) Y851C probably damaging Het
Mefv A G 16: 3,531,499 (GRCm39) S470P probably benign Het
Mfsd2a C T 4: 122,843,091 (GRCm39) V397I probably benign Het
Mroh1 C A 15: 76,318,073 (GRCm39) H867N probably benign Het
Mthfd1l C T 10: 3,957,745 (GRCm39) R261* probably null Het
Myo3a A G 2: 22,412,157 (GRCm39) I725M probably damaging Het
Neb T C 2: 52,099,552 (GRCm39) D4766G possibly damaging Het
Nek11 G T 9: 105,270,156 (GRCm39) P22Q probably damaging Het
Or4p18 T C 2: 88,232,457 (GRCm39) T274A possibly damaging Het
Or5k15 T C 16: 58,709,948 (GRCm39) T212A probably benign Het
Or9q2 A T 19: 13,772,603 (GRCm39) V124E possibly damaging Het
Peg10 C G 6: 4,756,113 (GRCm39) Q230E unknown Het
Pipox T C 11: 77,774,735 (GRCm39) D116G probably benign Het
Pkd1l2 C T 8: 117,774,236 (GRCm39) R993H probably benign Het
Pkdrej A C 15: 85,702,611 (GRCm39) N1108K probably damaging Het
Polr2a C T 11: 69,637,202 (GRCm39) R291Q probably benign Het
Pomt1 T A 2: 32,134,309 (GRCm39) Y277N probably damaging Het
Rasal2 A G 1: 157,126,805 (GRCm39) S78P probably damaging Het
Rgl1 A T 1: 152,433,252 (GRCm39) L171Q probably damaging Het
Sfta2 A G 17: 35,912,666 (GRCm39) E14G unknown Het
Sh3rf3 T A 10: 58,885,177 (GRCm39) S353R possibly damaging Het
Slc37a1 A T 17: 31,541,233 (GRCm39) I242F probably damaging Het
Srfbp1 T A 18: 52,621,762 (GRCm39) D274E probably damaging Het
Syne2 T A 12: 75,959,127 (GRCm39) S685R possibly damaging Het
Tenm4 A C 7: 96,544,383 (GRCm39) D2170A probably damaging Het
Tnr A G 1: 159,691,265 (GRCm39) T472A probably damaging Het
Tspan9 T C 6: 127,942,241 (GRCm39) H203R probably damaging Het
Ttn T C 2: 76,601,995 (GRCm39) T18556A possibly damaging Het
Usp25 T A 16: 76,868,569 (GRCm39) Y323* probably null Het
Usp31 G T 7: 121,248,249 (GRCm39) R1065S possibly damaging Het
Vmn2r103 A T 17: 20,032,058 (GRCm39) T611S probably damaging Het
Wdfy4 A G 14: 32,864,317 (GRCm39) V552A Het
Zap70 G T 1: 36,810,262 (GRCm39) R124L possibly damaging Het
Zfand6 A T 7: 84,281,957 (GRCm39) S91T possibly damaging Het
Other mutations in Bcat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Bcat2 APN 7 45,237,684 (GRCm39) missense probably damaging 0.97
IGL02383:Bcat2 APN 7 45,237,431 (GRCm39) missense probably damaging 1.00
IGL03157:Bcat2 APN 7 45,224,922 (GRCm39) missense probably benign
IGL03226:Bcat2 APN 7 45,237,778 (GRCm39) missense probably damaging 1.00
Bearcat UTSW 7 45,237,792 (GRCm39) missense possibly damaging 0.76
prematurely UTSW 7 45,237,446 (GRCm39) critical splice donor site probably null
skunkbear UTSW 7 45,225,294 (GRCm39) missense probably damaging 0.99
P0022:Bcat2 UTSW 7 45,237,769 (GRCm39) missense probably damaging 1.00
R1251:Bcat2 UTSW 7 45,225,410 (GRCm39) missense probably damaging 1.00
R1940:Bcat2 UTSW 7 45,237,792 (GRCm39) missense possibly damaging 0.76
R5446:Bcat2 UTSW 7 45,234,569 (GRCm39) missense possibly damaging 0.88
R6243:Bcat2 UTSW 7 45,237,691 (GRCm39) missense probably benign 0.19
R6932:Bcat2 UTSW 7 45,238,745 (GRCm39) missense probably damaging 0.98
R7336:Bcat2 UTSW 7 45,224,909 (GRCm39) missense probably benign 0.00
R7434:Bcat2 UTSW 7 45,225,429 (GRCm39) splice site probably null
R7645:Bcat2 UTSW 7 45,237,387 (GRCm39) missense probably benign 0.04
R7732:Bcat2 UTSW 7 45,234,617 (GRCm39) missense possibly damaging 0.65
R7736:Bcat2 UTSW 7 45,234,617 (GRCm39) missense possibly damaging 0.65
R8474:Bcat2 UTSW 7 45,237,075 (GRCm39) missense probably damaging 1.00
R8782:Bcat2 UTSW 7 45,234,917 (GRCm39) missense probably benign
R9112:Bcat2 UTSW 7 45,237,446 (GRCm39) critical splice donor site probably null
R9320:Bcat2 UTSW 7 45,234,542 (GRCm39) missense probably damaging 0.97
R9365:Bcat2 UTSW 7 45,225,294 (GRCm39) missense probably damaging 0.99
R9449:Bcat2 UTSW 7 45,234,980 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTTTCCCAGCAGCCTTAGG -3'
(R):5'- GTTGTTGCTCACAAGCTCACG -3'

Sequencing Primer
(F):5'- CAGCAGCCTTAGGGAGGG -3'
(R):5'- GAGCTCACCTGAATAGCCTTC -3'
Posted On 2020-06-30