Incidental Mutation 'R8140:Bcat2'
ID632477
Institutional Source Beutler Lab
Gene Symbol Bcat2
Ensembl Gene ENSMUSG00000030826
Gene Namebranched chain aminotransferase 2, mitochondrial
SynonymsEca40, Bcat-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R8140 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45570153-45589711 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45588351 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 347 (P347L)
Ref Sequence ENSEMBL: ENSMUSP00000033098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033098] [ENSMUST00000120864] [ENSMUST00000209204] [ENSMUST00000210811] [ENSMUST00000211173]
Predicted Effect probably damaging
Transcript: ENSMUST00000033098
AA Change: P347L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033098
Gene: ENSMUSG00000030826
AA Change: P347L

DomainStartEndE-ValueType
Pfam:Aminotran_4 101 351 5.4e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120864
AA Change: P342L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113045
Gene: ENSMUSG00000030826
AA Change: P342L

DomainStartEndE-ValueType
Pfam:Aminotran_4 119 370 7.6e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209204
AA Change: P307L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000209410
Predicted Effect probably benign
Transcript: ENSMUST00000210811
Predicted Effect probably damaging
Transcript: ENSMUST00000211173
AA Change: P307L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a branched chain aminotransferase found in mitochondria. The encoded protein forms a dimer that catalyzes the first step in the production of the branched chain amino acids leucine, isoleucine, and valine. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: The metabolism of branched chain amino acid is impaired in homozygous null mice, resulting in a phenotype similar to human maple syrup urine disease. Mutants exhibit a failure to thrive and die prematurely, though the severity of the symptoms can be ameliorated with a restricted diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,611 V230E possibly damaging Het
Amotl1 G A 9: 14,572,715 probably null Het
Atp7b C A 8: 22,028,560 E87D probably damaging Het
Brox A T 1: 183,293,873 probably null Het
Cd37 A G 7: 45,238,535 I58T probably damaging Het
Cep295 A T 9: 15,341,533 M333K probably benign Het
Chtop A G 3: 90,505,393 probably null Het
Cpa2 A T 6: 30,544,905 K54N probably benign Het
Cpa6 A G 1: 10,325,294 S383P probably damaging Het
Dnah7a A T 1: 53,501,589 I2542N probably benign Het
Eif5b G A 1: 38,051,276 V1179I probably benign Het
Erbin T C 13: 103,920,294 probably null Het
Fastkd5 A T 2: 130,615,250 D473E possibly damaging Het
Fchsd1 T C 18: 37,964,342 E372G probably damaging Het
Fgl1 T C 8: 41,200,609 probably null Het
Fzd8 T G 18: 9,213,797 V293G probably damaging Het
Gm4787 T A 12: 81,378,151 H411L probably benign Het
Gm49380 G T 9: 44,111,972 D326E probably benign Het
Hcrtr1 G A 4: 130,135,290 R240C probably damaging Het
Hdac5 A T 11: 102,197,355 Y948N probably damaging Het
Hepacam A G 9: 37,383,871 S301G probably benign Het
Htra4 A T 8: 25,030,558 D362E possibly damaging Het
Ighv1-9 G A 12: 114,583,741 P60L probably damaging Het
Kcnq3 A G 15: 65,995,541 I751T probably damaging Het
Magi3 T C 3: 104,034,086 Y851C probably damaging Het
Mefv A G 16: 3,713,635 S470P probably benign Het
Mfsd2a C T 4: 122,949,298 V397I probably benign Het
Mroh1 C A 15: 76,433,873 H867N probably benign Het
Mthfd1l C T 10: 4,007,745 R261* probably null Het
Myo3a A G 2: 22,407,346 I725M probably damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nek11 G T 9: 105,392,957 P22Q probably damaging Het
Olfr1179 T C 2: 88,402,113 T274A possibly damaging Het
Olfr1497 A T 19: 13,795,239 V124E possibly damaging Het
Olfr178 T C 16: 58,889,585 T212A probably benign Het
Peg10 C G 6: 4,756,113 Q230E unknown Het
Pipox T C 11: 77,883,909 D116G probably benign Het
Pkd1l2 C T 8: 117,047,497 R993H probably benign Het
Pkdrej A C 15: 85,818,410 N1108K probably damaging Het
Polr2a C T 11: 69,746,376 R291Q probably benign Het
Pomt1 T A 2: 32,244,297 Y277N probably damaging Het
Rasal2 A G 1: 157,299,235 S78P probably damaging Het
Rgl1 A T 1: 152,557,501 L171Q probably damaging Het
Sfta2 A G 17: 35,601,774 E14G unknown Het
Sh3rf3 T A 10: 59,049,355 S353R possibly damaging Het
Slc37a1 A T 17: 31,322,259 I242F probably damaging Het
Srfbp1 T A 18: 52,488,690 D274E probably damaging Het
Syne2 T A 12: 75,912,353 S685R possibly damaging Het
Tenm4 A C 7: 96,895,176 D2170A probably damaging Het
Tnr A G 1: 159,863,695 T472A probably damaging Het
Tspan9 T C 6: 127,965,278 H203R probably damaging Het
Ttn T C 2: 76,771,651 T18556A possibly damaging Het
Usp25 T A 16: 77,071,681 Y323* probably null Het
Usp31 G T 7: 121,649,026 R1065S possibly damaging Het
Vmn2r103 A T 17: 19,811,796 T611S probably damaging Het
Wdfy4 A G 14: 33,142,360 V552A Het
Zap70 G T 1: 36,771,181 R124L possibly damaging Het
Zfand6 A T 7: 84,632,749 S91T possibly damaging Het
Other mutations in Bcat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Bcat2 APN 7 45588260 missense probably damaging 0.97
IGL02383:Bcat2 APN 7 45588007 missense probably damaging 1.00
IGL03157:Bcat2 APN 7 45575498 missense probably benign
IGL03226:Bcat2 APN 7 45588354 missense probably damaging 1.00
P0022:Bcat2 UTSW 7 45588345 missense probably damaging 1.00
R1251:Bcat2 UTSW 7 45575986 missense probably damaging 1.00
R1940:Bcat2 UTSW 7 45588368 missense possibly damaging 0.76
R5446:Bcat2 UTSW 7 45585145 missense possibly damaging 0.88
R6243:Bcat2 UTSW 7 45588267 missense probably benign 0.19
R6932:Bcat2 UTSW 7 45589321 missense probably damaging 0.98
R7336:Bcat2 UTSW 7 45575485 missense probably benign 0.00
R7434:Bcat2 UTSW 7 45576005 splice site probably null
R7645:Bcat2 UTSW 7 45587963 missense probably benign 0.04
R7732:Bcat2 UTSW 7 45585193 missense possibly damaging 0.65
R7736:Bcat2 UTSW 7 45585193 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TCTTTCCCAGCAGCCTTAGG -3'
(R):5'- GTTGTTGCTCACAAGCTCACG -3'

Sequencing Primer
(F):5'- CAGCAGCCTTAGGGAGGG -3'
(R):5'- GAGCTCACCTGAATAGCCTTC -3'
Posted On2020-06-30