Mutagenetix > Incidental Mutations

Incidental Mutation 'R8140:Bcat2'

632477

Institutional Source

Beutler Lab

Gene Symbol

Bcat2

Ensembl Gene

ENSMUSG00000030826

Gene Name

branched chain aminotransferase 2, mitochondrial

Synonyms

Eca40, Bcat-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R8140 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

45570153-45589711 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 45588351 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 347 (P347L)

Ref Sequence

ENSEMBL: ENSMUSP00000033098 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033098] [ENSMUST00000120864] [ENSMUST00000209204] [ENSMUST00000210811] [ENSMUST00000211173]

AlphaFold

O35855

Predicted Effect

probably damaging
Transcript: ENSMUST00000033098
AA Change: P347L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033098
Gene: ENSMUSG00000030826
AA Change: P347L

Domain	Start	End	E-Value	Type
Pfam:Aminotran_4	101	351	5.4e-33	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000120864
AA Change: P342L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113045
Gene: ENSMUSG00000030826
AA Change: P342L

Domain	Start	End	E-Value	Type
Pfam:Aminotran_4	119	370	7.6e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000209204
AA Change: P307L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000209410

Predicted Effect

probably benign
Transcript: ENSMUST00000210811

Predicted Effect

probably damaging
Transcript: ENSMUST00000211173
AA Change: P307L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 93.9%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a branched chain aminotransferase found in mitochondria. The encoded protein forms a dimer that catalyzes the first step in the production of the branched chain amino acids leucine, isoleucine, and valine. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: The metabolism of branched chain amino acid is impaired in homozygous null mice, resulting in a phenotype similar to human maple syrup urine disease. Mutants exhibit a failure to thrive and die prematurely, though the severity of the symptoms can be ameliorated with a restricted diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,611	V230E	possibly damaging	Het
Amotl1	G	A	9: 14,572,715		probably null	Het
Atp7b	C	A	8: 22,028,560	E87D	probably damaging	Het
Brox	A	T	1: 183,293,873		probably null	Het
Cd37	A	G	7: 45,238,535	I58T	probably damaging	Het
Cep295	A	T	9: 15,341,533	M333K	probably benign	Het
Chtop	A	G	3: 90,505,393		probably null	Het
Cpa2	A	T	6: 30,544,905	K54N	probably benign	Het
Cpa6	A	G	1: 10,325,294	S383P	probably damaging	Het
Dnah7a	A	T	1: 53,501,589	I2542N	probably benign	Het
Eif5b	G	A	1: 38,051,276	V1179I	probably benign	Het
Erbin	T	C	13: 103,920,294		probably null	Het
Fastkd5	A	T	2: 130,615,250	D473E	possibly damaging	Het
Fchsd1	T	C	18: 37,964,342	E372G	probably damaging	Het
Fgl1	T	C	8: 41,200,609		probably null	Het
Fzd8	T	G	18: 9,213,797	V293G	probably damaging	Het
Gm4787	T	A	12: 81,378,151	H411L	probably benign	Het
Gm49380	G	T	9: 44,111,972	D326E	probably benign	Het
Hcrtr1	G	A	4: 130,135,290	R240C	probably damaging	Het
Hdac5	A	T	11: 102,197,355	Y948N	probably damaging	Het
Hepacam	A	G	9: 37,383,871	S301G	probably benign	Het
Htra4	A	T	8: 25,030,558	D362E	possibly damaging	Het
Ighv1-9	G	A	12: 114,583,741	P60L	probably damaging	Het
Kcnq3	A	G	15: 65,995,541	I751T	probably damaging	Het
Magi3	T	C	3: 104,034,086	Y851C	probably damaging	Het
Mefv	A	G	16: 3,713,635	S470P	probably benign	Het
Mfsd2a	C	T	4: 122,949,298	V397I	probably benign	Het
Mroh1	C	A	15: 76,433,873	H867N	probably benign	Het
Mthfd1l	C	T	10: 4,007,745	R261*	probably null	Het
Myo3a	A	G	2: 22,407,346	I725M	probably damaging	Het
Neb	T	C	2: 52,209,540	D4766G	possibly damaging	Het
Nek11	G	T	9: 105,392,957	P22Q	probably damaging	Het
Olfr1179	T	C	2: 88,402,113	T274A	possibly damaging	Het
Olfr1497	A	T	19: 13,795,239	V124E	possibly damaging	Het
Olfr178	T	C	16: 58,889,585	T212A	probably benign	Het
Peg10	C	G	6: 4,756,113	Q230E	unknown	Het
Pipox	T	C	11: 77,883,909	D116G	probably benign	Het
Pkd1l2	C	T	8: 117,047,497	R993H	probably benign	Het
Pkdrej	A	C	15: 85,818,410	N1108K	probably damaging	Het
Polr2a	C	T	11: 69,746,376	R291Q	probably benign	Het
Pomt1	T	A	2: 32,244,297	Y277N	probably damaging	Het
Rasal2	A	G	1: 157,299,235	S78P	probably damaging	Het
Rgl1	A	T	1: 152,557,501	L171Q	probably damaging	Het
Sfta2	A	G	17: 35,601,774	E14G	unknown	Het
Sh3rf3	T	A	10: 59,049,355	S353R	possibly damaging	Het
Slc37a1	A	T	17: 31,322,259	I242F	probably damaging	Het
Srfbp1	T	A	18: 52,488,690	D274E	probably damaging	Het
Syne2	T	A	12: 75,912,353	S685R	possibly damaging	Het
Tenm4	A	C	7: 96,895,176	D2170A	probably damaging	Het
Tnr	A	G	1: 159,863,695	T472A	probably damaging	Het
Tspan9	T	C	6: 127,965,278	H203R	probably damaging	Het
Ttn	T	C	2: 76,771,651	T18556A	possibly damaging	Het
Usp25	T	A	16: 77,071,681	Y323*	probably null	Het
Usp31	G	T	7: 121,649,026	R1065S	possibly damaging	Het
Vmn2r103	A	T	17: 19,811,796	T611S	probably damaging	Het
Wdfy4	A	G	14: 33,142,360	V552A		Het
Zap70	G	T	1: 36,771,181	R124L	possibly damaging	Het
Zfand6	A	T	7: 84,632,749	S91T	possibly damaging	Het

Other mutations in Bcat2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01382:Bcat2	APN	7	45588260	missense	probably damaging	0.97
IGL02383:Bcat2	APN	7	45588007	missense	probably damaging	1.00
IGL03157:Bcat2	APN	7	45575498	missense	probably benign
IGL03226:Bcat2	APN	7	45588354	missense	probably damaging	1.00
P0022:Bcat2	UTSW	7	45588345	missense	probably damaging	1.00
R1251:Bcat2	UTSW	7	45575986	missense	probably damaging	1.00
R1940:Bcat2	UTSW	7	45588368	missense	possibly damaging	0.76
R5446:Bcat2	UTSW	7	45585145	missense	possibly damaging	0.88
R6243:Bcat2	UTSW	7	45588267	missense	probably benign	0.19
R6932:Bcat2	UTSW	7	45589321	missense	probably damaging	0.98
R7336:Bcat2	UTSW	7	45575485	missense	probably benign	0.00
R7434:Bcat2	UTSW	7	45576005	splice site	probably null
R7645:Bcat2	UTSW	7	45587963	missense	probably benign	0.04
R7732:Bcat2	UTSW	7	45585193	missense	possibly damaging	0.65
R7736:Bcat2	UTSW	7	45585193	missense	possibly damaging	0.65
R8474:Bcat2	UTSW	7	45587651	missense	probably damaging	1.00
R8782:Bcat2	UTSW	7	45585493	missense	probably benign
R9112:Bcat2	UTSW	7	45588022	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCTTTCCCAGCAGCCTTAGG -3'
(R):5'- GTTGTTGCTCACAAGCTCACG -3'

Sequencing Primer
(F):5'- CAGCAGCCTTAGGGAGGG -3'
(R):5'- GAGCTCACCTGAATAGCCTTC -3'

Posted On

2020-06-30