Incidental Mutation 'R8140:Zfand6'
ID 632478
Institutional Source Beutler Lab
Gene Symbol Zfand6
Ensembl Gene ENSMUSG00000030629
Gene Name zinc finger, AN1-type domain 6
Synonyms Za20d3, 3110005P07Rik, Awp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock # R8140 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 84613766-84689959 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 84632749 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 91 (S91T)
Ref Sequence ENSEMBL: ENSMUSP00000069228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069537] [ENSMUST00000178385] [ENSMUST00000207865] [ENSMUST00000207975] [ENSMUST00000208782] [ENSMUST00000209117] [ENSMUST00000209165]
AlphaFold Q9DCH6
Predicted Effect possibly damaging
Transcript: ENSMUST00000069537
AA Change: S91T

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000069228
Gene: ENSMUSG00000030629
AA Change: S91T

DomainStartEndE-ValueType
ZnF_A20 11 35 1.91e-10 SMART
ZnF_AN1 164 201 1.46e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000178385
AA Change: S91T

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135968
Gene: ENSMUSG00000030629
AA Change: S91T

DomainStartEndE-ValueType
ZnF_A20 11 35 1.91e-10 SMART
ZnF_AN1 164 201 1.46e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000207865
AA Change: S91T

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000207975
Predicted Effect possibly damaging
Transcript: ENSMUST00000208782
AA Change: S91T

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209117
AA Change: S91T

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209165
AA Change: S91T

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,611 V230E possibly damaging Het
Amotl1 G A 9: 14,572,715 probably null Het
Atp7b C A 8: 22,028,560 E87D probably damaging Het
Bcat2 C T 7: 45,588,351 P347L probably damaging Het
Brox A T 1: 183,293,873 probably null Het
Cd37 A G 7: 45,238,535 I58T probably damaging Het
Cep295 A T 9: 15,341,533 M333K probably benign Het
Chtop A G 3: 90,505,393 probably null Het
Cpa2 A T 6: 30,544,905 K54N probably benign Het
Cpa6 A G 1: 10,325,294 S383P probably damaging Het
Dnah7a A T 1: 53,501,589 I2542N probably benign Het
Eif5b G A 1: 38,051,276 V1179I probably benign Het
Erbin T C 13: 103,920,294 probably null Het
Fastkd5 A T 2: 130,615,250 D473E possibly damaging Het
Fchsd1 T C 18: 37,964,342 E372G probably damaging Het
Fgl1 T C 8: 41,200,609 probably null Het
Fzd8 T G 18: 9,213,797 V293G probably damaging Het
Gm4787 T A 12: 81,378,151 H411L probably benign Het
Gm49380 G T 9: 44,111,972 D326E probably benign Het
Hcrtr1 G A 4: 130,135,290 R240C probably damaging Het
Hdac5 A T 11: 102,197,355 Y948N probably damaging Het
Hepacam A G 9: 37,383,871 S301G probably benign Het
Htra4 A T 8: 25,030,558 D362E possibly damaging Het
Ighv1-9 G A 12: 114,583,741 P60L probably damaging Het
Kcnq3 A G 15: 65,995,541 I751T probably damaging Het
Magi3 T C 3: 104,034,086 Y851C probably damaging Het
Mefv A G 16: 3,713,635 S470P probably benign Het
Mfsd2a C T 4: 122,949,298 V397I probably benign Het
Mroh1 C A 15: 76,433,873 H867N probably benign Het
Mthfd1l C T 10: 4,007,745 R261* probably null Het
Myo3a A G 2: 22,407,346 I725M probably damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nek11 G T 9: 105,392,957 P22Q probably damaging Het
Olfr1179 T C 2: 88,402,113 T274A possibly damaging Het
Olfr1497 A T 19: 13,795,239 V124E possibly damaging Het
Olfr178 T C 16: 58,889,585 T212A probably benign Het
Peg10 C G 6: 4,756,113 Q230E unknown Het
Pipox T C 11: 77,883,909 D116G probably benign Het
Pkd1l2 C T 8: 117,047,497 R993H probably benign Het
Pkdrej A C 15: 85,818,410 N1108K probably damaging Het
Polr2a C T 11: 69,746,376 R291Q probably benign Het
Pomt1 T A 2: 32,244,297 Y277N probably damaging Het
Rasal2 A G 1: 157,299,235 S78P probably damaging Het
Rgl1 A T 1: 152,557,501 L171Q probably damaging Het
Sfta2 A G 17: 35,601,774 E14G unknown Het
Sh3rf3 T A 10: 59,049,355 S353R possibly damaging Het
Slc37a1 A T 17: 31,322,259 I242F probably damaging Het
Srfbp1 T A 18: 52,488,690 D274E probably damaging Het
Syne2 T A 12: 75,912,353 S685R possibly damaging Het
Tenm4 A C 7: 96,895,176 D2170A probably damaging Het
Tnr A G 1: 159,863,695 T472A probably damaging Het
Tspan9 T C 6: 127,965,278 H203R probably damaging Het
Ttn T C 2: 76,771,651 T18556A possibly damaging Het
Usp25 T A 16: 77,071,681 Y323* probably null Het
Usp31 G T 7: 121,649,026 R1065S possibly damaging Het
Vmn2r103 A T 17: 19,811,796 T611S probably damaging Het
Wdfy4 A G 14: 33,142,360 V552A Het
Zap70 G T 1: 36,771,181 R124L possibly damaging Het
Other mutations in Zfand6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02396:Zfand6 APN 7 84617903 missense probably damaging 0.99
IGL03162:Zfand6 APN 7 84633977 missense probably benign 0.01
R0780:Zfand6 UTSW 7 84615834 missense probably damaging 1.00
R1055:Zfand6 UTSW 7 84615973 splice site probably benign
R2427:Zfand6 UTSW 7 84634290 nonsense probably null
R3683:Zfand6 UTSW 7 84634362 missense probably damaging 1.00
R3685:Zfand6 UTSW 7 84634362 missense probably damaging 1.00
R4663:Zfand6 UTSW 7 84617885 missense probably benign 0.27
R4939:Zfand6 UTSW 7 84615822 makesense probably null
R6013:Zfand6 UTSW 7 84632692 missense probably benign 0.00
R6867:Zfand6 UTSW 7 84615914 missense probably damaging 1.00
R7113:Zfand6 UTSW 7 84615869 missense probably damaging 1.00
R7692:Zfand6 UTSW 7 84633933 missense not run
R8755:Zfand6 UTSW 7 84632691 missense probably benign
R9185:Zfand6 UTSW 7 84634350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTCTAAATACCCACATCTATGC -3'
(R):5'- TGATCATGGTAGGTTACAAGTGTCTC -3'

Sequencing Primer
(F):5'- ACATCTATGCTAGTGCCCGG -3'
(R):5'- CAAGTGTCTCTGTTTTCTATAGGAAG -3'
Posted On 2020-06-30