Incidental Mutation 'R8140:Usp31'
ID 632480
Institutional Source Beutler Lab
Gene Symbol Usp31
Ensembl Gene ENSMUSG00000063317
Gene Name ubiquitin specific peptidase 31
Synonyms 6330567E21Rik
MMRRC Submission 067568-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.133) question?
Stock # R8140 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 121241244-121306476 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 121248249 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 1065 (R1065S)
Ref Sequence ENSEMBL: ENSMUSP00000040037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046929]
AlphaFold E9Q6Y8
Predicted Effect possibly damaging
Transcript: ENSMUST00000046929
AA Change: R1065S

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040037
Gene: ENSMUSG00000063317
AA Change: R1065S

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 29 58 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 90 120 N/A INTRINSIC
Pfam:UCH 122 755 2.5e-64 PFAM
Pfam:UCH_1 562 737 1.3e-12 PFAM
low complexity region 763 777 N/A INTRINSIC
low complexity region 792 811 N/A INTRINSIC
low complexity region 831 847 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
low complexity region 985 996 N/A INTRINSIC
low complexity region 1009 1030 N/A INTRINSIC
low complexity region 1044 1060 N/A INTRINSIC
low complexity region 1072 1127 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1192 1204 N/A INTRINSIC
low complexity region 1245 1258 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 64,055,954 (GRCm39) V230E possibly damaging Het
Amotl1 G A 9: 14,484,011 (GRCm39) probably null Het
Atp7b C A 8: 22,518,576 (GRCm39) E87D probably damaging Het
Bcat2 C T 7: 45,237,775 (GRCm39) P347L probably damaging Het
Brox A T 1: 183,075,437 (GRCm39) probably null Het
Cd37 A G 7: 44,887,959 (GRCm39) I58T probably damaging Het
Cep295 A T 9: 15,252,829 (GRCm39) M333K probably benign Het
Chtop A G 3: 90,412,700 (GRCm39) probably null Het
Cpa2 A T 6: 30,544,904 (GRCm39) K54N probably benign Het
Cpa6 A G 1: 10,395,519 (GRCm39) S383P probably damaging Het
Dnah7a A T 1: 53,540,748 (GRCm39) I2542N probably benign Het
Eif5b G A 1: 38,090,357 (GRCm39) V1179I probably benign Het
Erbin T C 13: 104,056,802 (GRCm39) probably null Het
Fastkd5 A T 2: 130,457,170 (GRCm39) D473E possibly damaging Het
Fchsd1 T C 18: 38,097,395 (GRCm39) E372G probably damaging Het
Fgl1 T C 8: 41,653,646 (GRCm39) probably null Het
Fzd8 T G 18: 9,213,797 (GRCm39) V293G probably damaging Het
Gm4787 T A 12: 81,424,925 (GRCm39) H411L probably benign Het
Gm49380 G T 9: 44,023,269 (GRCm39) D326E probably benign Het
Hcrtr1 G A 4: 130,029,083 (GRCm39) R240C probably damaging Het
Hdac5 A T 11: 102,088,181 (GRCm39) Y948N probably damaging Het
Hepacam A G 9: 37,295,167 (GRCm39) S301G probably benign Het
Htra4 A T 8: 25,520,574 (GRCm39) D362E possibly damaging Het
Ighv1-9 G A 12: 114,547,361 (GRCm39) P60L probably damaging Het
Kcnq3 A G 15: 65,867,390 (GRCm39) I751T probably damaging Het
Magi3 T C 3: 103,941,402 (GRCm39) Y851C probably damaging Het
Mefv A G 16: 3,531,499 (GRCm39) S470P probably benign Het
Mfsd2a C T 4: 122,843,091 (GRCm39) V397I probably benign Het
Mroh1 C A 15: 76,318,073 (GRCm39) H867N probably benign Het
Mthfd1l C T 10: 3,957,745 (GRCm39) R261* probably null Het
Myo3a A G 2: 22,412,157 (GRCm39) I725M probably damaging Het
Neb T C 2: 52,099,552 (GRCm39) D4766G possibly damaging Het
Nek11 G T 9: 105,270,156 (GRCm39) P22Q probably damaging Het
Or4p18 T C 2: 88,232,457 (GRCm39) T274A possibly damaging Het
Or5k15 T C 16: 58,709,948 (GRCm39) T212A probably benign Het
Or9q2 A T 19: 13,772,603 (GRCm39) V124E possibly damaging Het
Peg10 C G 6: 4,756,113 (GRCm39) Q230E unknown Het
Pipox T C 11: 77,774,735 (GRCm39) D116G probably benign Het
Pkd1l2 C T 8: 117,774,236 (GRCm39) R993H probably benign Het
Pkdrej A C 15: 85,702,611 (GRCm39) N1108K probably damaging Het
Polr2a C T 11: 69,637,202 (GRCm39) R291Q probably benign Het
Pomt1 T A 2: 32,134,309 (GRCm39) Y277N probably damaging Het
Rasal2 A G 1: 157,126,805 (GRCm39) S78P probably damaging Het
Rgl1 A T 1: 152,433,252 (GRCm39) L171Q probably damaging Het
Sfta2 A G 17: 35,912,666 (GRCm39) E14G unknown Het
Sh3rf3 T A 10: 58,885,177 (GRCm39) S353R possibly damaging Het
Slc37a1 A T 17: 31,541,233 (GRCm39) I242F probably damaging Het
Srfbp1 T A 18: 52,621,762 (GRCm39) D274E probably damaging Het
Syne2 T A 12: 75,959,127 (GRCm39) S685R possibly damaging Het
Tenm4 A C 7: 96,544,383 (GRCm39) D2170A probably damaging Het
Tnr A G 1: 159,691,265 (GRCm39) T472A probably damaging Het
Tspan9 T C 6: 127,942,241 (GRCm39) H203R probably damaging Het
Ttn T C 2: 76,601,995 (GRCm39) T18556A possibly damaging Het
Usp25 T A 16: 76,868,569 (GRCm39) Y323* probably null Het
Vmn2r103 A T 17: 20,032,058 (GRCm39) T611S probably damaging Het
Wdfy4 A G 14: 32,864,317 (GRCm39) V552A Het
Zap70 G T 1: 36,810,262 (GRCm39) R124L possibly damaging Het
Zfand6 A T 7: 84,281,957 (GRCm39) S91T possibly damaging Het
Other mutations in Usp31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Usp31 APN 7 121,305,893 (GRCm39) missense probably damaging 1.00
IGL00421:Usp31 APN 7 121,247,873 (GRCm39) missense probably damaging 0.96
IGL00657:Usp31 APN 7 121,247,454 (GRCm39) missense probably benign 0.00
IGL01917:Usp31 APN 7 121,278,708 (GRCm39) missense probably benign 0.26
IGL02444:Usp31 APN 7 121,278,718 (GRCm39) missense probably damaging 1.00
IGL03090:Usp31 APN 7 121,278,753 (GRCm39) splice site probably benign
R0334:Usp31 UTSW 7 121,258,185 (GRCm39) missense probably damaging 0.99
R0945:Usp31 UTSW 7 121,269,476 (GRCm39) missense probably damaging 1.00
R1326:Usp31 UTSW 7 121,247,525 (GRCm39) missense probably damaging 1.00
R2116:Usp31 UTSW 7 121,247,919 (GRCm39) missense probably benign 0.39
R3113:Usp31 UTSW 7 121,278,736 (GRCm39) missense probably damaging 1.00
R4072:Usp31 UTSW 7 121,267,005 (GRCm39) splice site probably null
R4075:Usp31 UTSW 7 121,267,005 (GRCm39) splice site probably null
R4076:Usp31 UTSW 7 121,267,005 (GRCm39) splice site probably null
R4306:Usp31 UTSW 7 121,306,152 (GRCm39) missense possibly damaging 0.93
R4675:Usp31 UTSW 7 121,306,548 (GRCm39) unclassified probably benign
R4960:Usp31 UTSW 7 121,247,868 (GRCm39) missense probably damaging 0.99
R5368:Usp31 UTSW 7 121,260,588 (GRCm39) missense probably damaging 1.00
R5396:Usp31 UTSW 7 121,267,005 (GRCm39) splice site probably null
R5456:Usp31 UTSW 7 121,269,500 (GRCm39) missense probably damaging 1.00
R5475:Usp31 UTSW 7 121,250,749 (GRCm39) missense probably damaging 1.00
R5497:Usp31 UTSW 7 121,250,824 (GRCm39) missense probably damaging 1.00
R5872:Usp31 UTSW 7 121,248,698 (GRCm39) missense probably benign 0.05
R6301:Usp31 UTSW 7 121,247,499 (GRCm39) missense possibly damaging 0.76
R6688:Usp31 UTSW 7 121,277,553 (GRCm39) missense probably benign 0.01
R6875:Usp31 UTSW 7 121,248,863 (GRCm39) nonsense probably null
R6895:Usp31 UTSW 7 121,252,399 (GRCm39) missense probably benign 0.00
R7570:Usp31 UTSW 7 121,274,186 (GRCm39) missense probably damaging 1.00
R7633:Usp31 UTSW 7 121,258,185 (GRCm39) missense probably damaging 0.99
R7666:Usp31 UTSW 7 121,248,404 (GRCm39) missense possibly damaging 0.68
R7841:Usp31 UTSW 7 121,276,535 (GRCm39) missense probably damaging 0.96
R7841:Usp31 UTSW 7 121,247,679 (GRCm39) missense probably benign 0.00
R8013:Usp31 UTSW 7 121,248,480 (GRCm39) missense probably damaging 0.99
R8014:Usp31 UTSW 7 121,248,480 (GRCm39) missense probably damaging 0.99
R8118:Usp31 UTSW 7 121,276,485 (GRCm39) missense probably damaging 1.00
R9063:Usp31 UTSW 7 121,306,466 (GRCm39) missense probably benign
R9795:Usp31 UTSW 7 121,247,499 (GRCm39) missense probably benign 0.00
X0062:Usp31 UTSW 7 121,250,737 (GRCm39) missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGTCCTGCTCTTCCCAGAAG -3'
(R):5'- TTCTCTCACAAAGAAGCCAGAG -3'

Sequencing Primer
(F):5'- GTGACAGGGCTTGGGGC -3'
(R):5'- TCTCACAAAGAAGCCAGAGAGCAC -3'
Posted On 2020-06-30