Mutagenetix > Incidental Mutations

Incidental Mutation 'R8140:Atp7b'

632481

Institutional Source

Beutler Lab

Gene Symbol

Atp7b

Ensembl Gene

ENSMUSG00000006567

Gene Name

ATPase, Cu++ transporting, beta polypeptide

Synonyms

Atp7a, WND, Wilson protein

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.701) question?

Stock #

R8140 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21992785-22060305 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 22028560 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 87 (E87D)

Ref Sequence

ENSEMBL: ENSMUSP00000006742 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006742] [ENSMUST00000110738]

AlphaFold

Q64446

Predicted Effect

probably damaging
Transcript: ENSMUST00000006742
AA Change: E87D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000006742
Gene: ENSMUSG00000006567
AA Change: E87D

Domain	Start	End	E-Value	Type
Pfam:HMA	71	132	8.8e-14	PFAM
Pfam:HMA	156	217	6.6e-13	PFAM
Pfam:HMA	271	329	7.4e-13	PFAM
Pfam:HMA	364	425	1.1e-10	PFAM
Pfam:HMA	493	554	2.3e-14	PFAM
Pfam:HMA	569	630	3.1e-15	PFAM
transmembrane domain	656	675	N/A	INTRINSIC
Pfam:E1-E2_ATPase	770	1018	3.3e-60	PFAM
Pfam:Hydrolase	1023	1276	1.3e-67	PFAM
Pfam:HAD	1026	1273	4.6e-10	PFAM
Pfam:Hydrolase_3	1243	1308	5.1e-7	PFAM
transmembrane domain	1322	1344	N/A	INTRINSIC
low complexity region	1353	1370	N/A	INTRINSIC
low complexity region	1418	1437	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110738
AA Change: E75D

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000106366
Gene: ENSMUSG00000006567
AA Change: E75D

Domain	Start	End	E-Value	Type
Pfam:HMA	59	120	1.2e-13	PFAM
Pfam:HMA	144	205	9.7e-12	PFAM
PDB:2AW0\|A	259	314	6e-6	PDB
Pfam:HMA	378	439	1.6e-13	PFAM
Pfam:HMA	454	515	1.5e-15	PFAM
transmembrane domain	541	560	N/A	INTRINSIC
Pfam:E1-E2_ATPase	656	904	4.6e-50	PFAM
Pfam:Hydrolase	908	1161	6.6e-76	PFAM
Pfam:HAD	911	1158	1.5e-15	PFAM
Pfam:Hydrolase_3	1128	1193	8.5e-7	PFAM
transmembrane domain	1207	1229	N/A	INTRINSIC
low complexity region	1238	1255	N/A	INTRINSIC
low complexity region	1303	1322	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 93.9%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the P-type cation transport ATPase family and encodes a protein with several membrane-spanning domains, an ATPase consensus sequence, a hinge domain, a phosphorylation site, and at least 2 putative copper-binding sites. This protein functions as a monomer, exporting copper out of the cells, such as the efflux of hepatic copper into the bile. Alternate transcriptional splice variants, encoding different isoforms with distinct cellular localizations, have been characterized. Mutations in this gene have been associated with Wilson disease (WD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of the mouse gene results in copper accumulation in various organs, primarily the liver, kidney and brain, and a form of liver cirrhosis that resembles Wilson disease in humans and the 'toxic milk' phenotype in mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,611	V230E	possibly damaging	Het
Amotl1	G	A	9: 14,572,715		probably null	Het
Bcat2	C	T	7: 45,588,351	P347L	probably damaging	Het
Brox	A	T	1: 183,293,873		probably null	Het
Cd37	A	G	7: 45,238,535	I58T	probably damaging	Het
Cep295	A	T	9: 15,341,533	M333K	probably benign	Het
Chtop	A	G	3: 90,505,393		probably null	Het
Cpa2	A	T	6: 30,544,905	K54N	probably benign	Het
Cpa6	A	G	1: 10,325,294	S383P	probably damaging	Het
Dnah7a	A	T	1: 53,501,589	I2542N	probably benign	Het
Eif5b	G	A	1: 38,051,276	V1179I	probably benign	Het
Erbin	T	C	13: 103,920,294		probably null	Het
Fastkd5	A	T	2: 130,615,250	D473E	possibly damaging	Het
Fchsd1	T	C	18: 37,964,342	E372G	probably damaging	Het
Fgl1	T	C	8: 41,200,609		probably null	Het
Fzd8	T	G	18: 9,213,797	V293G	probably damaging	Het
Gm4787	T	A	12: 81,378,151	H411L	probably benign	Het
Gm49380	G	T	9: 44,111,972	D326E	probably benign	Het
Hcrtr1	G	A	4: 130,135,290	R240C	probably damaging	Het
Hdac5	A	T	11: 102,197,355	Y948N	probably damaging	Het
Hepacam	A	G	9: 37,383,871	S301G	probably benign	Het
Htra4	A	T	8: 25,030,558	D362E	possibly damaging	Het
Ighv1-9	G	A	12: 114,583,741	P60L	probably damaging	Het
Kcnq3	A	G	15: 65,995,541	I751T	probably damaging	Het
Magi3	T	C	3: 104,034,086	Y851C	probably damaging	Het
Mefv	A	G	16: 3,713,635	S470P	probably benign	Het
Mfsd2a	C	T	4: 122,949,298	V397I	probably benign	Het
Mroh1	C	A	15: 76,433,873	H867N	probably benign	Het
Mthfd1l	C	T	10: 4,007,745	R261*	probably null	Het
Myo3a	A	G	2: 22,407,346	I725M	probably damaging	Het
Neb	T	C	2: 52,209,540	D4766G	possibly damaging	Het
Nek11	G	T	9: 105,392,957	P22Q	probably damaging	Het
Olfr1179	T	C	2: 88,402,113	T274A	possibly damaging	Het
Olfr1497	A	T	19: 13,795,239	V124E	possibly damaging	Het
Olfr178	T	C	16: 58,889,585	T212A	probably benign	Het
Peg10	C	G	6: 4,756,113	Q230E	unknown	Het
Pipox	T	C	11: 77,883,909	D116G	probably benign	Het
Pkd1l2	C	T	8: 117,047,497	R993H	probably benign	Het
Pkdrej	A	C	15: 85,818,410	N1108K	probably damaging	Het
Polr2a	C	T	11: 69,746,376	R291Q	probably benign	Het
Pomt1	T	A	2: 32,244,297	Y277N	probably damaging	Het
Rasal2	A	G	1: 157,299,235	S78P	probably damaging	Het
Rgl1	A	T	1: 152,557,501	L171Q	probably damaging	Het
Sfta2	A	G	17: 35,601,774	E14G	unknown	Het
Sh3rf3	T	A	10: 59,049,355	S353R	possibly damaging	Het
Slc37a1	A	T	17: 31,322,259	I242F	probably damaging	Het
Srfbp1	T	A	18: 52,488,690	D274E	probably damaging	Het
Syne2	T	A	12: 75,912,353	S685R	possibly damaging	Het
Tenm4	A	C	7: 96,895,176	D2170A	probably damaging	Het
Tnr	A	G	1: 159,863,695	T472A	probably damaging	Het
Tspan9	T	C	6: 127,965,278	H203R	probably damaging	Het
Ttn	T	C	2: 76,771,651	T18556A	possibly damaging	Het
Usp25	T	A	16: 77,071,681	Y323*	probably null	Het
Usp31	G	T	7: 121,649,026	R1065S	possibly damaging	Het
Vmn2r103	A	T	17: 19,811,796	T611S	probably damaging	Het
Wdfy4	A	G	14: 33,142,360	V552A		Het
Zap70	G	T	1: 36,771,181	R124L	possibly damaging	Het
Zfand6	A	T	7: 84,632,749	S91T	possibly damaging	Het

Other mutations in Atp7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Atp7b	APN	8	22011098	missense	possibly damaging	0.91
IGL00981:Atp7b	APN	8	22027527	splice site	probably null
IGL01600:Atp7b	APN	8	22027525	splice site	probably null
IGL01713:Atp7b	APN	8	22028573	missense	probably damaging	1.00
IGL01778:Atp7b	APN	8	21994828	missense	probably benign	0.42
IGL01926:Atp7b	APN	8	22011781	missense	probably damaging	0.98
IGL02312:Atp7b	APN	8	21994770	missense	probably damaging	0.99
IGL02562:Atp7b	APN	8	22028085	missense	probably benign
IGL02573:Atp7b	APN	8	22022470	missense	probably benign	0.00
IGL02603:Atp7b	APN	8	21994776	missense	possibly damaging	0.88
IGL02622:Atp7b	APN	8	22028438	missense	possibly damaging	0.69
IGL02721:Atp7b	APN	8	22022477	missense	probably benign	0.00
IGL03145:Atp7b	APN	8	22018143	missense	probably damaging	1.00
daffodil	UTSW	8	21998266	missense	probably damaging	1.00
menace	UTSW	8	22022365	missense	probably damaging	0.97
PIT4131001:Atp7b	UTSW	8	21994656	missense	probably damaging	1.00
R0023:Atp7b	UTSW	8	22011073	missense	probably damaging	1.00
R0046:Atp7b	UTSW	8	22059995	missense	probably benign	0.00
R0128:Atp7b	UTSW	8	22028172	missense	possibly damaging	0.47
R0130:Atp7b	UTSW	8	22028172	missense	possibly damaging	0.47
R0325:Atp7b	UTSW	8	22028451	missense	probably benign	0.22
R0412:Atp7b	UTSW	8	21995659	splice site	probably null
R0856:Atp7b	UTSW	8	21997631	missense	probably damaging	1.00
R0906:Atp7b	UTSW	8	22027826	missense	probably benign
R0989:Atp7b	UTSW	8	22028694	missense	possibly damaging	0.51
R1377:Atp7b	UTSW	8	22011785	missense	probably benign	0.17
R1517:Atp7b	UTSW	8	21997358	missense	probably damaging	1.00
R1521:Atp7b	UTSW	8	22027673	missense	probably damaging	0.96
R1529:Atp7b	UTSW	8	22028724	missense	possibly damaging	0.87
R1691:Atp7b	UTSW	8	22011023	missense	possibly damaging	0.90
R1743:Atp7b	UTSW	8	22006387	missense	probably damaging	1.00
R1815:Atp7b	UTSW	8	22011651	missense	possibly damaging	0.80
R2008:Atp7b	UTSW	8	22027980	missense	probably damaging	1.00
R2133:Atp7b	UTSW	8	22011077	missense	probably damaging	1.00
R2155:Atp7b	UTSW	8	22013584	missense	possibly damaging	0.69
R2182:Atp7b	UTSW	8	22014547	missense	probably damaging	0.99
R2256:Atp7b	UTSW	8	21998266	missense	probably damaging	1.00
R2257:Atp7b	UTSW	8	21998266	missense	probably damaging	1.00
R2274:Atp7b	UTSW	8	22020832	missense	probably benign	0.20
R2475:Atp7b	UTSW	8	21994776	missense	possibly damaging	0.88
R2906:Atp7b	UTSW	8	22011554	missense	probably damaging	1.00
R2907:Atp7b	UTSW	8	22011554	missense	probably damaging	1.00
R3421:Atp7b	UTSW	8	22028670	missense	probably damaging	1.00
R3422:Atp7b	UTSW	8	22028670	missense	probably damaging	1.00
R3688:Atp7b	UTSW	8	22004230	missense	probably damaging	1.00
R3945:Atp7b	UTSW	8	22020864	missense	probably benign	0.02
R4235:Atp7b	UTSW	8	22011023	missense	possibly damaging	0.90
R4700:Atp7b	UTSW	8	22000121	missense	probably benign	0.00
R4701:Atp7b	UTSW	8	22000121	missense	probably benign	0.00
R4877:Atp7b	UTSW	8	22028601	missense	probably damaging	0.98
R4962:Atp7b	UTSW	8	22020885	missense	probably damaging	1.00
R5009:Atp7b	UTSW	8	22027698	missense	possibly damaging	0.88
R5016:Atp7b	UTSW	8	22015869	splice site	probably null
R5038:Atp7b	UTSW	8	22028456	missense	possibly damaging	0.67
R5438:Atp7b	UTSW	8	22014554	missense	probably benign
R5467:Atp7b	UTSW	8	22011554	missense	probably damaging	1.00
R5468:Atp7b	UTSW	8	22059970	critical splice donor site	probably null
R5512:Atp7b	UTSW	8	22012739	missense	probably benign	0.20
R5563:Atp7b	UTSW	8	22028714	missense	possibly damaging	0.82
R5751:Atp7b	UTSW	8	22018128	missense	probably damaging	1.00
R5773:Atp7b	UTSW	8	22027863	missense	probably benign
R5941:Atp7b	UTSW	8	21997496	missense	probably damaging	0.98
R6227:Atp7b	UTSW	8	22020825	missense	possibly damaging	0.63
R6265:Atp7b	UTSW	8	22015927	nonsense	probably null
R6290:Atp7b	UTSW	8	22020820	missense	probably damaging	1.00
R6368:Atp7b	UTSW	8	22020755	splice site	probably null
R6647:Atp7b	UTSW	8	22028478	missense	probably damaging	1.00
R6788:Atp7b	UTSW	8	22004375	missense	probably benign	0.37
R6830:Atp7b	UTSW	8	22022365	missense	probably damaging	0.97
R6886:Atp7b	UTSW	8	22028690	missense	probably benign	0.01
R6928:Atp7b	UTSW	8	21994812	missense	probably benign
R6965:Atp7b	UTSW	8	22028085	missense	probably benign
R7203:Atp7b	UTSW	8	21997335	missense	probably damaging	1.00
R7222:Atp7b	UTSW	8	22022378	nonsense	probably null
R7344:Atp7b	UTSW	8	21997499	missense	probably damaging	1.00
R7384:Atp7b	UTSW	8	22022315	missense	probably benign	0.01
R7449:Atp7b	UTSW	8	22011849	missense	probably damaging	0.98
R7451:Atp7b	UTSW	8	22014684	nonsense	probably null
R7607:Atp7b	UTSW	8	22011506	missense	probably damaging	1.00
R8160:Atp7b	UTSW	8	21997559	missense	probably damaging	0.98
R8349:Atp7b	UTSW	8	22013540	missense	probably damaging	1.00
R8421:Atp7b	UTSW	8	22028471	missense	probably benign	0.01
R8449:Atp7b	UTSW	8	22013540	missense	probably damaging	1.00
R8749:Atp7b	UTSW	8	22028318	missense	probably damaging	0.96
R8989:Atp7b	UTSW	8	22020895	missense	probably benign	0.06
R9210:Atp7b	UTSW	8	21997390	missense	probably damaging	1.00
R9353:Atp7b	UTSW	8	22027874	missense	possibly damaging	0.78
Z1176:Atp7b	UTSW	8	22028714	missense	probably benign	0.07
Z1177:Atp7b	UTSW	8	21994877	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTGACAGGTCATGCCCTCTAC -3'
(R):5'- TAAACTTGCTTTGCCCGGCC -3'

Sequencing Primer
(F):5'- TCTACCCGGAGCTTGACCAC -3'
(R):5'- CGGCCCTGGGAGCAATC -3'

Posted On

2020-06-30