Incidental Mutation 'R8140:Atp7b'
ID 632481
Institutional Source Beutler Lab
Gene Symbol Atp7b
Ensembl Gene ENSMUSG00000006567
Gene Name ATPase, Cu++ transporting, beta polypeptide
Synonyms Atp7a, WND, Wilson protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.701) question?
Stock # R8140 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 21992785-22060305 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 22028560 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 87 (E87D)
Ref Sequence ENSEMBL: ENSMUSP00000006742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006742] [ENSMUST00000110738]
AlphaFold Q64446
Predicted Effect probably damaging
Transcript: ENSMUST00000006742
AA Change: E87D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006742
Gene: ENSMUSG00000006567
AA Change: E87D

DomainStartEndE-ValueType
Pfam:HMA 71 132 8.8e-14 PFAM
Pfam:HMA 156 217 6.6e-13 PFAM
Pfam:HMA 271 329 7.4e-13 PFAM
Pfam:HMA 364 425 1.1e-10 PFAM
Pfam:HMA 493 554 2.3e-14 PFAM
Pfam:HMA 569 630 3.1e-15 PFAM
transmembrane domain 656 675 N/A INTRINSIC
Pfam:E1-E2_ATPase 770 1018 3.3e-60 PFAM
Pfam:Hydrolase 1023 1276 1.3e-67 PFAM
Pfam:HAD 1026 1273 4.6e-10 PFAM
Pfam:Hydrolase_3 1243 1308 5.1e-7 PFAM
transmembrane domain 1322 1344 N/A INTRINSIC
low complexity region 1353 1370 N/A INTRINSIC
low complexity region 1418 1437 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110738
AA Change: E75D

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106366
Gene: ENSMUSG00000006567
AA Change: E75D

DomainStartEndE-ValueType
Pfam:HMA 59 120 1.2e-13 PFAM
Pfam:HMA 144 205 9.7e-12 PFAM
PDB:2AW0|A 259 314 6e-6 PDB
Pfam:HMA 378 439 1.6e-13 PFAM
Pfam:HMA 454 515 1.5e-15 PFAM
transmembrane domain 541 560 N/A INTRINSIC
Pfam:E1-E2_ATPase 656 904 4.6e-50 PFAM
Pfam:Hydrolase 908 1161 6.6e-76 PFAM
Pfam:HAD 911 1158 1.5e-15 PFAM
Pfam:Hydrolase_3 1128 1193 8.5e-7 PFAM
transmembrane domain 1207 1229 N/A INTRINSIC
low complexity region 1238 1255 N/A INTRINSIC
low complexity region 1303 1322 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the P-type cation transport ATPase family and encodes a protein with several membrane-spanning domains, an ATPase consensus sequence, a hinge domain, a phosphorylation site, and at least 2 putative copper-binding sites. This protein functions as a monomer, exporting copper out of the cells, such as the efflux of hepatic copper into the bile. Alternate transcriptional splice variants, encoding different isoforms with distinct cellular localizations, have been characterized. Mutations in this gene have been associated with Wilson disease (WD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of the mouse gene results in copper accumulation in various organs, primarily the liver, kidney and brain, and a form of liver cirrhosis that resembles Wilson disease in humans and the 'toxic milk' phenotype in mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,611 V230E possibly damaging Het
Amotl1 G A 9: 14,572,715 probably null Het
Bcat2 C T 7: 45,588,351 P347L probably damaging Het
Brox A T 1: 183,293,873 probably null Het
Cd37 A G 7: 45,238,535 I58T probably damaging Het
Cep295 A T 9: 15,341,533 M333K probably benign Het
Chtop A G 3: 90,505,393 probably null Het
Cpa2 A T 6: 30,544,905 K54N probably benign Het
Cpa6 A G 1: 10,325,294 S383P probably damaging Het
Dnah7a A T 1: 53,501,589 I2542N probably benign Het
Eif5b G A 1: 38,051,276 V1179I probably benign Het
Erbin T C 13: 103,920,294 probably null Het
Fastkd5 A T 2: 130,615,250 D473E possibly damaging Het
Fchsd1 T C 18: 37,964,342 E372G probably damaging Het
Fgl1 T C 8: 41,200,609 probably null Het
Fzd8 T G 18: 9,213,797 V293G probably damaging Het
Gm4787 T A 12: 81,378,151 H411L probably benign Het
Gm49380 G T 9: 44,111,972 D326E probably benign Het
Hcrtr1 G A 4: 130,135,290 R240C probably damaging Het
Hdac5 A T 11: 102,197,355 Y948N probably damaging Het
Hepacam A G 9: 37,383,871 S301G probably benign Het
Htra4 A T 8: 25,030,558 D362E possibly damaging Het
Ighv1-9 G A 12: 114,583,741 P60L probably damaging Het
Kcnq3 A G 15: 65,995,541 I751T probably damaging Het
Magi3 T C 3: 104,034,086 Y851C probably damaging Het
Mefv A G 16: 3,713,635 S470P probably benign Het
Mfsd2a C T 4: 122,949,298 V397I probably benign Het
Mroh1 C A 15: 76,433,873 H867N probably benign Het
Mthfd1l C T 10: 4,007,745 R261* probably null Het
Myo3a A G 2: 22,407,346 I725M probably damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nek11 G T 9: 105,392,957 P22Q probably damaging Het
Olfr1179 T C 2: 88,402,113 T274A possibly damaging Het
Olfr1497 A T 19: 13,795,239 V124E possibly damaging Het
Olfr178 T C 16: 58,889,585 T212A probably benign Het
Peg10 C G 6: 4,756,113 Q230E unknown Het
Pipox T C 11: 77,883,909 D116G probably benign Het
Pkd1l2 C T 8: 117,047,497 R993H probably benign Het
Pkdrej A C 15: 85,818,410 N1108K probably damaging Het
Polr2a C T 11: 69,746,376 R291Q probably benign Het
Pomt1 T A 2: 32,244,297 Y277N probably damaging Het
Rasal2 A G 1: 157,299,235 S78P probably damaging Het
Rgl1 A T 1: 152,557,501 L171Q probably damaging Het
Sfta2 A G 17: 35,601,774 E14G unknown Het
Sh3rf3 T A 10: 59,049,355 S353R possibly damaging Het
Slc37a1 A T 17: 31,322,259 I242F probably damaging Het
Srfbp1 T A 18: 52,488,690 D274E probably damaging Het
Syne2 T A 12: 75,912,353 S685R possibly damaging Het
Tenm4 A C 7: 96,895,176 D2170A probably damaging Het
Tnr A G 1: 159,863,695 T472A probably damaging Het
Tspan9 T C 6: 127,965,278 H203R probably damaging Het
Ttn T C 2: 76,771,651 T18556A possibly damaging Het
Usp25 T A 16: 77,071,681 Y323* probably null Het
Usp31 G T 7: 121,649,026 R1065S possibly damaging Het
Vmn2r103 A T 17: 19,811,796 T611S probably damaging Het
Wdfy4 A G 14: 33,142,360 V552A Het
Zap70 G T 1: 36,771,181 R124L possibly damaging Het
Zfand6 A T 7: 84,632,749 S91T possibly damaging Het
Other mutations in Atp7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Atp7b APN 8 22011098 missense possibly damaging 0.91
IGL00981:Atp7b APN 8 22027527 splice site probably null
IGL01600:Atp7b APN 8 22027525 splice site probably null
IGL01713:Atp7b APN 8 22028573 missense probably damaging 1.00
IGL01778:Atp7b APN 8 21994828 missense probably benign 0.42
IGL01926:Atp7b APN 8 22011781 missense probably damaging 0.98
IGL02312:Atp7b APN 8 21994770 missense probably damaging 0.99
IGL02562:Atp7b APN 8 22028085 missense probably benign
IGL02573:Atp7b APN 8 22022470 missense probably benign 0.00
IGL02603:Atp7b APN 8 21994776 missense possibly damaging 0.88
IGL02622:Atp7b APN 8 22028438 missense possibly damaging 0.69
IGL02721:Atp7b APN 8 22022477 missense probably benign 0.00
IGL03145:Atp7b APN 8 22018143 missense probably damaging 1.00
daffodil UTSW 8 21998266 missense probably damaging 1.00
menace UTSW 8 22022365 missense probably damaging 0.97
PIT4131001:Atp7b UTSW 8 21994656 missense probably damaging 1.00
R0023:Atp7b UTSW 8 22011073 missense probably damaging 1.00
R0046:Atp7b UTSW 8 22059995 missense probably benign 0.00
R0128:Atp7b UTSW 8 22028172 missense possibly damaging 0.47
R0130:Atp7b UTSW 8 22028172 missense possibly damaging 0.47
R0325:Atp7b UTSW 8 22028451 missense probably benign 0.22
R0412:Atp7b UTSW 8 21995659 splice site probably null
R0856:Atp7b UTSW 8 21997631 missense probably damaging 1.00
R0906:Atp7b UTSW 8 22027826 missense probably benign
R0989:Atp7b UTSW 8 22028694 missense possibly damaging 0.51
R1377:Atp7b UTSW 8 22011785 missense probably benign 0.17
R1517:Atp7b UTSW 8 21997358 missense probably damaging 1.00
R1521:Atp7b UTSW 8 22027673 missense probably damaging 0.96
R1529:Atp7b UTSW 8 22028724 missense possibly damaging 0.87
R1691:Atp7b UTSW 8 22011023 missense possibly damaging 0.90
R1743:Atp7b UTSW 8 22006387 missense probably damaging 1.00
R1815:Atp7b UTSW 8 22011651 missense possibly damaging 0.80
R2008:Atp7b UTSW 8 22027980 missense probably damaging 1.00
R2133:Atp7b UTSW 8 22011077 missense probably damaging 1.00
R2155:Atp7b UTSW 8 22013584 missense possibly damaging 0.69
R2182:Atp7b UTSW 8 22014547 missense probably damaging 0.99
R2256:Atp7b UTSW 8 21998266 missense probably damaging 1.00
R2257:Atp7b UTSW 8 21998266 missense probably damaging 1.00
R2274:Atp7b UTSW 8 22020832 missense probably benign 0.20
R2475:Atp7b UTSW 8 21994776 missense possibly damaging 0.88
R2906:Atp7b UTSW 8 22011554 missense probably damaging 1.00
R2907:Atp7b UTSW 8 22011554 missense probably damaging 1.00
R3421:Atp7b UTSW 8 22028670 missense probably damaging 1.00
R3422:Atp7b UTSW 8 22028670 missense probably damaging 1.00
R3688:Atp7b UTSW 8 22004230 missense probably damaging 1.00
R3945:Atp7b UTSW 8 22020864 missense probably benign 0.02
R4235:Atp7b UTSW 8 22011023 missense possibly damaging 0.90
R4700:Atp7b UTSW 8 22000121 missense probably benign 0.00
R4701:Atp7b UTSW 8 22000121 missense probably benign 0.00
R4877:Atp7b UTSW 8 22028601 missense probably damaging 0.98
R4962:Atp7b UTSW 8 22020885 missense probably damaging 1.00
R5009:Atp7b UTSW 8 22027698 missense possibly damaging 0.88
R5016:Atp7b UTSW 8 22015869 splice site probably null
R5038:Atp7b UTSW 8 22028456 missense possibly damaging 0.67
R5438:Atp7b UTSW 8 22014554 missense probably benign
R5467:Atp7b UTSW 8 22011554 missense probably damaging 1.00
R5468:Atp7b UTSW 8 22059970 critical splice donor site probably null
R5512:Atp7b UTSW 8 22012739 missense probably benign 0.20
R5563:Atp7b UTSW 8 22028714 missense possibly damaging 0.82
R5751:Atp7b UTSW 8 22018128 missense probably damaging 1.00
R5773:Atp7b UTSW 8 22027863 missense probably benign
R5941:Atp7b UTSW 8 21997496 missense probably damaging 0.98
R6227:Atp7b UTSW 8 22020825 missense possibly damaging 0.63
R6265:Atp7b UTSW 8 22015927 nonsense probably null
R6290:Atp7b UTSW 8 22020820 missense probably damaging 1.00
R6368:Atp7b UTSW 8 22020755 splice site probably null
R6647:Atp7b UTSW 8 22028478 missense probably damaging 1.00
R6788:Atp7b UTSW 8 22004375 missense probably benign 0.37
R6830:Atp7b UTSW 8 22022365 missense probably damaging 0.97
R6886:Atp7b UTSW 8 22028690 missense probably benign 0.01
R6928:Atp7b UTSW 8 21994812 missense probably benign
R6965:Atp7b UTSW 8 22028085 missense probably benign
R7203:Atp7b UTSW 8 21997335 missense probably damaging 1.00
R7222:Atp7b UTSW 8 22022378 nonsense probably null
R7344:Atp7b UTSW 8 21997499 missense probably damaging 1.00
R7384:Atp7b UTSW 8 22022315 missense probably benign 0.01
R7449:Atp7b UTSW 8 22011849 missense probably damaging 0.98
R7451:Atp7b UTSW 8 22014684 nonsense probably null
R7607:Atp7b UTSW 8 22011506 missense probably damaging 1.00
R8160:Atp7b UTSW 8 21997559 missense probably damaging 0.98
R8349:Atp7b UTSW 8 22013540 missense probably damaging 1.00
R8421:Atp7b UTSW 8 22028471 missense probably benign 0.01
R8449:Atp7b UTSW 8 22013540 missense probably damaging 1.00
R8749:Atp7b UTSW 8 22028318 missense probably damaging 0.96
R8989:Atp7b UTSW 8 22020895 missense probably benign 0.06
R9210:Atp7b UTSW 8 21997390 missense probably damaging 1.00
R9353:Atp7b UTSW 8 22027874 missense possibly damaging 0.78
Z1176:Atp7b UTSW 8 22028714 missense probably benign 0.07
Z1177:Atp7b UTSW 8 21994877 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGACAGGTCATGCCCTCTAC -3'
(R):5'- TAAACTTGCTTTGCCCGGCC -3'

Sequencing Primer
(F):5'- TCTACCCGGAGCTTGACCAC -3'
(R):5'- CGGCCCTGGGAGCAATC -3'
Posted On 2020-06-30