Incidental Mutation 'R8140:Htra4'
ID 632482
Institutional Source Beutler Lab
Gene Symbol Htra4
Ensembl Gene ENSMUSG00000037406
Gene Name HtrA serine peptidase 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8140 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 25024929-25038962 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25030558 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 362 (D362E)
Ref Sequence ENSEMBL: ENSMUSP00000081044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084031]
AlphaFold A2RT60
Predicted Effect possibly damaging
Transcript: ENSMUST00000084031
AA Change: D362E

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081044
Gene: ENSMUSG00000037406
AA Change: D362E

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IB 37 112 5.44e-7 SMART
KAZAL 109 158 7.92e-4 SMART
Pfam:Trypsin 182 368 5.5e-15 PFAM
Pfam:Trypsin_2 208 346 2.1e-34 PFAM
PDZ 385 470 5.34e-10 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HtrA family of proteases. The encoded protein contains a putative signal peptide, an insulin growth factor binding domain, a Kazal protease inhibitor domain, a conserved trypsin domain and a PDZ domain. Based on studies on other related family members, this enzyme may function as a secreted oligomeric chaperone protease to degrade misfolded secretory proteins. Other human HtrA proteins have been implicated in arthritis, tumor suppression, unfolded stress response, apoptosis, and aging. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,611 V230E possibly damaging Het
Amotl1 G A 9: 14,572,715 probably null Het
Atp7b C A 8: 22,028,560 E87D probably damaging Het
Bcat2 C T 7: 45,588,351 P347L probably damaging Het
Brox A T 1: 183,293,873 probably null Het
Cd37 A G 7: 45,238,535 I58T probably damaging Het
Cep295 A T 9: 15,341,533 M333K probably benign Het
Chtop A G 3: 90,505,393 probably null Het
Cpa2 A T 6: 30,544,905 K54N probably benign Het
Cpa6 A G 1: 10,325,294 S383P probably damaging Het
Dnah7a A T 1: 53,501,589 I2542N probably benign Het
Eif5b G A 1: 38,051,276 V1179I probably benign Het
Erbin T C 13: 103,920,294 probably null Het
Fastkd5 A T 2: 130,615,250 D473E possibly damaging Het
Fchsd1 T C 18: 37,964,342 E372G probably damaging Het
Fgl1 T C 8: 41,200,609 probably null Het
Fzd8 T G 18: 9,213,797 V293G probably damaging Het
Gm4787 T A 12: 81,378,151 H411L probably benign Het
Gm49380 G T 9: 44,111,972 D326E probably benign Het
Hcrtr1 G A 4: 130,135,290 R240C probably damaging Het
Hdac5 A T 11: 102,197,355 Y948N probably damaging Het
Hepacam A G 9: 37,383,871 S301G probably benign Het
Ighv1-9 G A 12: 114,583,741 P60L probably damaging Het
Kcnq3 A G 15: 65,995,541 I751T probably damaging Het
Magi3 T C 3: 104,034,086 Y851C probably damaging Het
Mefv A G 16: 3,713,635 S470P probably benign Het
Mfsd2a C T 4: 122,949,298 V397I probably benign Het
Mroh1 C A 15: 76,433,873 H867N probably benign Het
Mthfd1l C T 10: 4,007,745 R261* probably null Het
Myo3a A G 2: 22,407,346 I725M probably damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nek11 G T 9: 105,392,957 P22Q probably damaging Het
Olfr1179 T C 2: 88,402,113 T274A possibly damaging Het
Olfr1497 A T 19: 13,795,239 V124E possibly damaging Het
Olfr178 T C 16: 58,889,585 T212A probably benign Het
Peg10 C G 6: 4,756,113 Q230E unknown Het
Pipox T C 11: 77,883,909 D116G probably benign Het
Pkd1l2 C T 8: 117,047,497 R993H probably benign Het
Pkdrej A C 15: 85,818,410 N1108K probably damaging Het
Polr2a C T 11: 69,746,376 R291Q probably benign Het
Pomt1 T A 2: 32,244,297 Y277N probably damaging Het
Rasal2 A G 1: 157,299,235 S78P probably damaging Het
Rgl1 A T 1: 152,557,501 L171Q probably damaging Het
Sfta2 A G 17: 35,601,774 E14G unknown Het
Sh3rf3 T A 10: 59,049,355 S353R possibly damaging Het
Slc37a1 A T 17: 31,322,259 I242F probably damaging Het
Srfbp1 T A 18: 52,488,690 D274E probably damaging Het
Syne2 T A 12: 75,912,353 S685R possibly damaging Het
Tenm4 A C 7: 96,895,176 D2170A probably damaging Het
Tnr A G 1: 159,863,695 T472A probably damaging Het
Tspan9 T C 6: 127,965,278 H203R probably damaging Het
Ttn T C 2: 76,771,651 T18556A possibly damaging Het
Usp25 T A 16: 77,071,681 Y323* probably null Het
Usp31 G T 7: 121,649,026 R1065S possibly damaging Het
Vmn2r103 A T 17: 19,811,796 T611S probably damaging Het
Wdfy4 A G 14: 33,142,360 V552A Het
Zap70 G T 1: 36,771,181 R124L possibly damaging Het
Zfand6 A T 7: 84,632,749 S91T possibly damaging Het
Other mutations in Htra4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Htra4 APN 8 25033571 missense probably damaging 0.98
IGL01738:Htra4 APN 8 25025711 missense probably damaging 0.96
IGL02307:Htra4 APN 8 25033694 missense probably damaging 1.00
IGL03382:Htra4 APN 8 25029698 missense probably benign 0.17
R0057:Htra4 UTSW 8 25038808 missense probably benign
R0906:Htra4 UTSW 8 25037144 missense probably benign 0.00
R1075:Htra4 UTSW 8 25033596 missense probably benign 0.00
R1173:Htra4 UTSW 8 25030619 missense possibly damaging 0.92
R1180:Htra4 UTSW 8 25033719 missense probably damaging 1.00
R1854:Htra4 UTSW 8 25033581 missense probably damaging 1.00
R2030:Htra4 UTSW 8 25033577 missense probably damaging 1.00
R2225:Htra4 UTSW 8 25025720 missense probably benign 0.42
R4457:Htra4 UTSW 8 25038658 missense possibly damaging 0.90
R4626:Htra4 UTSW 8 25037114 missense probably benign 0.29
R4746:Htra4 UTSW 8 25033697 missense probably damaging 1.00
R4797:Htra4 UTSW 8 25033659 missense probably damaging 1.00
R5369:Htra4 UTSW 8 25033569 missense possibly damaging 0.95
R6846:Htra4 UTSW 8 25030545 missense probably damaging 1.00
R6911:Htra4 UTSW 8 25025705 missense probably damaging 0.96
R7067:Htra4 UTSW 8 25033701 missense probably damaging 1.00
R7367:Htra4 UTSW 8 25033697 missense probably damaging 1.00
R7446:Htra4 UTSW 8 25037165 missense probably benign 0.09
R7603:Htra4 UTSW 8 25025700 missense probably benign 0.03
R7725:Htra4 UTSW 8 25037153 missense possibly damaging 0.94
R7729:Htra4 UTSW 8 25037077 missense possibly damaging 0.63
R7893:Htra4 UTSW 8 25033679 missense possibly damaging 0.81
R7988:Htra4 UTSW 8 25030510 critical splice donor site probably null
R9169:Htra4 UTSW 8 25030117 missense probably damaging 1.00
R9223:Htra4 UTSW 8 25037032 missense possibly damaging 0.94
R9229:Htra4 UTSW 8 25038541 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGTTTTGTGATACGTGCCC -3'
(R):5'- AGGACATGTGCTTCTCCCTAATG -3'

Sequencing Primer
(F):5'- TGATACGTGCCCCGATATGG -3'
(R):5'- CTCCCTAATGAAGAAGTGGGTCTC -3'
Posted On 2020-06-30