Incidental Mutation 'R8140:Hepacam'
ID 632485
Institutional Source Beutler Lab
Gene Symbol Hepacam
Ensembl Gene ENSMUSG00000046240
Gene Name hepatocyte cell adhesion molecule
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock # R8140 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 37367351-37386575 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37383871 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 301 (S301G)
Ref Sequence ENSEMBL: ENSMUSP00000054105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051839] [ENSMUST00000215951]
AlphaFold Q640R3
Predicted Effect probably benign
Transcript: ENSMUST00000051839
AA Change: S301G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054105
Gene: ENSMUSG00000046240
AA Change: S301G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
IG 40 142 1e-3 SMART
IGc2 159 224 1.48e-6 SMART
transmembrane domain 241 263 N/A INTRINSIC
low complexity region 264 274 N/A INTRINSIC
low complexity region 337 356 N/A INTRINSIC
low complexity region 358 372 N/A INTRINSIC
low complexity region 379 396 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215951
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single-pass type I membrane protein that localizes to the cytoplasmic side of the cell membrane. The encoded protein acts as a homodimer and is involved in cell motility and cell-matrix interactions. The expression of this gene is downregulated or undetectable in many cancer cell lines, so this may be a tumor suppressor gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a null allele display myelin vacuolization that progresses with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,611 V230E possibly damaging Het
Amotl1 G A 9: 14,572,715 probably null Het
Atp7b C A 8: 22,028,560 E87D probably damaging Het
Bcat2 C T 7: 45,588,351 P347L probably damaging Het
Brox A T 1: 183,293,873 probably null Het
Cd37 A G 7: 45,238,535 I58T probably damaging Het
Cep295 A T 9: 15,341,533 M333K probably benign Het
Chtop A G 3: 90,505,393 probably null Het
Cpa2 A T 6: 30,544,905 K54N probably benign Het
Cpa6 A G 1: 10,325,294 S383P probably damaging Het
Dnah7a A T 1: 53,501,589 I2542N probably benign Het
Eif5b G A 1: 38,051,276 V1179I probably benign Het
Erbin T C 13: 103,920,294 probably null Het
Fastkd5 A T 2: 130,615,250 D473E possibly damaging Het
Fchsd1 T C 18: 37,964,342 E372G probably damaging Het
Fgl1 T C 8: 41,200,609 probably null Het
Fzd8 T G 18: 9,213,797 V293G probably damaging Het
Gm4787 T A 12: 81,378,151 H411L probably benign Het
Gm49380 G T 9: 44,111,972 D326E probably benign Het
Hcrtr1 G A 4: 130,135,290 R240C probably damaging Het
Hdac5 A T 11: 102,197,355 Y948N probably damaging Het
Htra4 A T 8: 25,030,558 D362E possibly damaging Het
Ighv1-9 G A 12: 114,583,741 P60L probably damaging Het
Kcnq3 A G 15: 65,995,541 I751T probably damaging Het
Magi3 T C 3: 104,034,086 Y851C probably damaging Het
Mefv A G 16: 3,713,635 S470P probably benign Het
Mfsd2a C T 4: 122,949,298 V397I probably benign Het
Mroh1 C A 15: 76,433,873 H867N probably benign Het
Mthfd1l C T 10: 4,007,745 R261* probably null Het
Myo3a A G 2: 22,407,346 I725M probably damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nek11 G T 9: 105,392,957 P22Q probably damaging Het
Olfr1179 T C 2: 88,402,113 T274A possibly damaging Het
Olfr1497 A T 19: 13,795,239 V124E possibly damaging Het
Olfr178 T C 16: 58,889,585 T212A probably benign Het
Peg10 C G 6: 4,756,113 Q230E unknown Het
Pipox T C 11: 77,883,909 D116G probably benign Het
Pkd1l2 C T 8: 117,047,497 R993H probably benign Het
Pkdrej A C 15: 85,818,410 N1108K probably damaging Het
Polr2a C T 11: 69,746,376 R291Q probably benign Het
Pomt1 T A 2: 32,244,297 Y277N probably damaging Het
Rasal2 A G 1: 157,299,235 S78P probably damaging Het
Rgl1 A T 1: 152,557,501 L171Q probably damaging Het
Sfta2 A G 17: 35,601,774 E14G unknown Het
Sh3rf3 T A 10: 59,049,355 S353R possibly damaging Het
Slc37a1 A T 17: 31,322,259 I242F probably damaging Het
Srfbp1 T A 18: 52,488,690 D274E probably damaging Het
Syne2 T A 12: 75,912,353 S685R possibly damaging Het
Tenm4 A C 7: 96,895,176 D2170A probably damaging Het
Tnr A G 1: 159,863,695 T472A probably damaging Het
Tspan9 T C 6: 127,965,278 H203R probably damaging Het
Ttn T C 2: 76,771,651 T18556A possibly damaging Het
Usp25 T A 16: 77,071,681 Y323* probably null Het
Usp31 G T 7: 121,649,026 R1065S possibly damaging Het
Vmn2r103 A T 17: 19,811,796 T611S probably damaging Het
Wdfy4 A G 14: 33,142,360 V552A Het
Zap70 G T 1: 36,771,181 R124L possibly damaging Het
Zfand6 A T 7: 84,632,749 S91T possibly damaging Het
Other mutations in Hepacam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01844:Hepacam APN 9 37380616 missense probably damaging 1.00
R0924:Hepacam UTSW 9 37383928 splice site probably benign
R1659:Hepacam UTSW 9 37380658 missense probably benign 0.08
R1748:Hepacam UTSW 9 37383893 missense possibly damaging 0.90
R4932:Hepacam UTSW 9 37381764 missense probably damaging 1.00
R5587:Hepacam UTSW 9 37384684 missense probably damaging 0.99
R5738:Hepacam UTSW 9 37383425 missense possibly damaging 0.83
R5809:Hepacam UTSW 9 37384805 missense possibly damaging 0.49
R6017:Hepacam UTSW 9 37380760 missense probably benign 0.00
R6825:Hepacam UTSW 9 37367680 missense possibly damaging 0.67
R7420:Hepacam UTSW 9 37380709 missense probably benign 0.00
R7825:Hepacam UTSW 9 37384768 missense probably benign 0.03
R8437:Hepacam UTSW 9 37384710 missense probably damaging 1.00
R8513:Hepacam UTSW 9 37380634 missense probably benign 0.01
R8547:Hepacam UTSW 9 37367753 missense probably benign 0.12
R8746:Hepacam UTSW 9 37381734 missense probably damaging 1.00
R9169:Hepacam UTSW 9 37382397 missense probably damaging 1.00
R9196:Hepacam UTSW 9 37367756 missense probably benign 0.00
X0024:Hepacam UTSW 9 37381600 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TGCAGGTACAGAATATAGGTGCTG -3'
(R):5'- CAGGTCTGCCACTCATTTGC -3'

Sequencing Primer
(F):5'- GGGGTAGAATGACCTTTTCTCAAAG -3'
(R):5'- CTCATTTTCCAATTTCTTAAGTGGGG -3'
Posted On 2020-06-30