Incidental Mutation 'R8140:Sh3rf3'
ID632489
Institutional Source Beutler Lab
Gene Symbol Sh3rf3
Ensembl Gene ENSMUSG00000037990
Gene NameSH3 domain containing ring finger 3
SynonymsSh3md4, 4831416G18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R8140 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location58813359-59138916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59049355 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 353 (S353R)
Ref Sequence ENSEMBL: ENSMUSP00000120938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135526] [ENSMUST00000153031]
Predicted Effect probably damaging
Transcript: ENSMUST00000135526
AA Change: S353R

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114368
Gene: ENSMUSG00000037990
AA Change: S353R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
RING 52 92 2.76e-7 SMART
low complexity region 119 152 N/A INTRINSIC
low complexity region 161 170 N/A INTRINSIC
SH3 190 245 8.24e-18 SMART
SH3 252 311 5.56e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000153031
AA Change: S353R

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120938
Gene: ENSMUSG00000037990
AA Change: S353R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
RING 52 92 2.76e-7 SMART
low complexity region 119 152 N/A INTRINSIC
low complexity region 161 170 N/A INTRINSIC
SH3 190 245 8.24e-18 SMART
SH3 252 311 5.56e-15 SMART
SH3 461 518 1.43e-17 SMART
low complexity region 707 739 N/A INTRINSIC
SH3 822 878 5.19e-15 SMART
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,611 V230E possibly damaging Het
Amotl1 G A 9: 14,572,715 probably null Het
Atp7b C A 8: 22,028,560 E87D probably damaging Het
Bcat2 C T 7: 45,588,351 P347L probably damaging Het
Brox A T 1: 183,293,873 probably null Het
Cd37 A G 7: 45,238,535 I58T probably damaging Het
Cep295 A T 9: 15,341,533 M333K probably benign Het
Chtop A G 3: 90,505,393 probably null Het
Cpa2 A T 6: 30,544,905 K54N probably benign Het
Cpa6 A G 1: 10,325,294 S383P probably damaging Het
Dnah7a A T 1: 53,501,589 I2542N probably benign Het
Eif5b G A 1: 38,051,276 V1179I probably benign Het
Erbin T C 13: 103,920,294 probably null Het
Fastkd5 A T 2: 130,615,250 D473E possibly damaging Het
Fchsd1 T C 18: 37,964,342 E372G probably damaging Het
Fgl1 T C 8: 41,200,609 probably null Het
Fzd8 T G 18: 9,213,797 V293G probably damaging Het
Gm4787 T A 12: 81,378,151 H411L probably benign Het
Gm49380 G T 9: 44,111,972 D326E probably benign Het
Hcrtr1 G A 4: 130,135,290 R240C probably damaging Het
Hdac5 A T 11: 102,197,355 Y948N probably damaging Het
Hepacam A G 9: 37,383,871 S301G probably benign Het
Htra4 A T 8: 25,030,558 D362E possibly damaging Het
Ighv1-9 G A 12: 114,583,741 P60L probably damaging Het
Kcnq3 A G 15: 65,995,541 I751T probably damaging Het
Magi3 T C 3: 104,034,086 Y851C probably damaging Het
Mefv A G 16: 3,713,635 S470P probably benign Het
Mfsd2a C T 4: 122,949,298 V397I probably benign Het
Mroh1 C A 15: 76,433,873 H867N probably benign Het
Mthfd1l C T 10: 4,007,745 R261* probably null Het
Myo3a A G 2: 22,407,346 I725M probably damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nek11 G T 9: 105,392,957 P22Q probably damaging Het
Olfr1179 T C 2: 88,402,113 T274A possibly damaging Het
Olfr1497 A T 19: 13,795,239 V124E possibly damaging Het
Olfr178 T C 16: 58,889,585 T212A probably benign Het
Peg10 C G 6: 4,756,113 Q230E unknown Het
Pipox T C 11: 77,883,909 D116G probably benign Het
Pkd1l2 C T 8: 117,047,497 R993H probably benign Het
Pkdrej A C 15: 85,818,410 N1108K probably damaging Het
Polr2a C T 11: 69,746,376 R291Q probably benign Het
Pomt1 T A 2: 32,244,297 Y277N probably damaging Het
Rasal2 A G 1: 157,299,235 S78P probably damaging Het
Rgl1 A T 1: 152,557,501 L171Q probably damaging Het
Sfta2 A G 17: 35,601,774 E14G unknown Het
Slc37a1 A T 17: 31,322,259 I242F probably damaging Het
Srfbp1 T A 18: 52,488,690 D274E probably damaging Het
Syne2 T A 12: 75,912,353 S685R possibly damaging Het
Tenm4 A C 7: 96,895,176 D2170A probably damaging Het
Tnr A G 1: 159,863,695 T472A probably damaging Het
Tspan9 T C 6: 127,965,278 H203R probably damaging Het
Ttn T C 2: 76,771,651 T18556A possibly damaging Het
Usp25 T A 16: 77,071,681 Y323* probably null Het
Usp31 G T 7: 121,649,026 R1065S possibly damaging Het
Vmn2r103 A T 17: 19,811,796 T611S probably damaging Het
Wdfy4 A G 14: 33,142,360 V552A Het
Zap70 G T 1: 36,771,181 R124L possibly damaging Het
Zfand6 A T 7: 84,632,749 S91T possibly damaging Het
Other mutations in Sh3rf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Sh3rf3 APN 10 59049356 missense probably benign 0.06
IGL01898:Sh3rf3 APN 10 59049530 missense probably damaging 0.99
IGL02108:Sh3rf3 APN 10 59135828 missense probably damaging 1.00
IGL02148:Sh3rf3 APN 10 59086740 missense probably benign 0.02
exasperated UTSW 10 59086824 missense probably benign 0.06
strained UTSW 10 59007103 missense probably damaging 1.00
R0421:Sh3rf3 UTSW 10 58984075 missense probably damaging 1.00
R1056:Sh3rf3 UTSW 10 59007082 missense probably damaging 1.00
R1313:Sh3rf3 UTSW 10 59071999 missense possibly damaging 0.92
R1313:Sh3rf3 UTSW 10 59071999 missense possibly damaging 0.92
R1615:Sh3rf3 UTSW 10 59131077 missense probably benign 0.02
R1797:Sh3rf3 UTSW 10 59086667 nonsense probably null
R1869:Sh3rf3 UTSW 10 59083513 missense probably damaging 1.00
R1924:Sh3rf3 UTSW 10 59104167 splice site probably benign
R1968:Sh3rf3 UTSW 10 58813987 missense probably benign 0.32
R2353:Sh3rf3 UTSW 10 59007073 missense probably damaging 1.00
R3617:Sh3rf3 UTSW 10 59086863 missense possibly damaging 0.83
R3769:Sh3rf3 UTSW 10 58984191 missense probably benign 0.07
R4059:Sh3rf3 UTSW 10 59083533 missense probably damaging 1.00
R4425:Sh3rf3 UTSW 10 59083576 missense probably benign 0.00
R4690:Sh3rf3 UTSW 10 58813704 missense possibly damaging 0.93
R4832:Sh3rf3 UTSW 10 58814083 missense probably benign 0.19
R4853:Sh3rf3 UTSW 10 59083519 missense probably damaging 1.00
R4854:Sh3rf3 UTSW 10 58813723 missense possibly damaging 0.93
R4917:Sh3rf3 UTSW 10 59007103 missense probably damaging 1.00
R4918:Sh3rf3 UTSW 10 59007103 missense probably damaging 1.00
R4995:Sh3rf3 UTSW 10 59086824 missense probably benign 0.06
R5125:Sh3rf3 UTSW 10 59131190 missense probably benign 0.14
R5640:Sh3rf3 UTSW 10 58813947 missense probably benign
R5716:Sh3rf3 UTSW 10 59131283 missense probably benign 0.03
R5756:Sh3rf3 UTSW 10 59104382 missense probably damaging 0.98
R5848:Sh3rf3 UTSW 10 58984153 missense possibly damaging 0.54
R5908:Sh3rf3 UTSW 10 59049448 missense probably benign 0.32
R5930:Sh3rf3 UTSW 10 59130986 missense probably damaging 1.00
R6036:Sh3rf3 UTSW 10 58813984 missense probably benign 0.19
R6036:Sh3rf3 UTSW 10 58813984 missense probably benign 0.19
R6392:Sh3rf3 UTSW 10 59007076 missense probably damaging 0.97
R6450:Sh3rf3 UTSW 10 58984144 missense probably damaging 1.00
R6470:Sh3rf3 UTSW 10 58983969 missense probably damaging 1.00
R6639:Sh3rf3 UTSW 10 59083467 missense probably damaging 1.00
R6685:Sh3rf3 UTSW 10 59086841 missense possibly damaging 0.95
R7292:Sh3rf3 UTSW 10 59071973 missense probably damaging 1.00
R7789:Sh3rf3 UTSW 10 59086815 missense probably benign 0.01
R7941:Sh3rf3 UTSW 10 59007061 missense probably damaging 0.99
R7959:Sh3rf3 UTSW 10 59007103 missense probably damaging 1.00
R8142:Sh3rf3 UTSW 10 59049383 nonsense probably null
R8241:Sh3rf3 UTSW 10 59104420 missense probably benign 0.11
R8406:Sh3rf3 UTSW 10 59083585 missense probably damaging 1.00
RF020:Sh3rf3 UTSW 10 58813768 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTCCATGTGTGAGCTCCGG -3'
(R):5'- AATTACCTGGGTGGGGACAG -3'

Sequencing Primer
(F):5'- ATGTGTGAGCTCCGGACAGG -3'
(R):5'- AAGCTCCCCAATCCTGGCTG -3'
Posted On2020-06-30