Incidental Mutation 'R8140:Sh3rf3'
ID 632489
Institutional Source Beutler Lab
Gene Symbol Sh3rf3
Ensembl Gene ENSMUSG00000037990
Gene Name SH3 domain containing ring finger 3
Synonyms Sh3md4, 4831416G18Rik
MMRRC Submission 067568-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R8140 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 58649181-58974738 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 58885177 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 353 (S353R)
Ref Sequence ENSEMBL: ENSMUSP00000120938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135526] [ENSMUST00000153031]
AlphaFold Q8C120
Predicted Effect probably damaging
Transcript: ENSMUST00000135526
AA Change: S353R

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114368
Gene: ENSMUSG00000037990
AA Change: S353R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
RING 52 92 2.76e-7 SMART
low complexity region 119 152 N/A INTRINSIC
low complexity region 161 170 N/A INTRINSIC
SH3 190 245 8.24e-18 SMART
SH3 252 311 5.56e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000153031
AA Change: S353R

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120938
Gene: ENSMUSG00000037990
AA Change: S353R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
RING 52 92 2.76e-7 SMART
low complexity region 119 152 N/A INTRINSIC
low complexity region 161 170 N/A INTRINSIC
SH3 190 245 8.24e-18 SMART
SH3 252 311 5.56e-15 SMART
SH3 461 518 1.43e-17 SMART
low complexity region 707 739 N/A INTRINSIC
SH3 822 878 5.19e-15 SMART
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 64,055,954 (GRCm39) V230E possibly damaging Het
Amotl1 G A 9: 14,484,011 (GRCm39) probably null Het
Atp7b C A 8: 22,518,576 (GRCm39) E87D probably damaging Het
Bcat2 C T 7: 45,237,775 (GRCm39) P347L probably damaging Het
Brox A T 1: 183,075,437 (GRCm39) probably null Het
Cd37 A G 7: 44,887,959 (GRCm39) I58T probably damaging Het
Cep295 A T 9: 15,252,829 (GRCm39) M333K probably benign Het
Chtop A G 3: 90,412,700 (GRCm39) probably null Het
Cpa2 A T 6: 30,544,904 (GRCm39) K54N probably benign Het
Cpa6 A G 1: 10,395,519 (GRCm39) S383P probably damaging Het
Dnah7a A T 1: 53,540,748 (GRCm39) I2542N probably benign Het
Eif5b G A 1: 38,090,357 (GRCm39) V1179I probably benign Het
Erbin T C 13: 104,056,802 (GRCm39) probably null Het
Fastkd5 A T 2: 130,457,170 (GRCm39) D473E possibly damaging Het
Fchsd1 T C 18: 38,097,395 (GRCm39) E372G probably damaging Het
Fgl1 T C 8: 41,653,646 (GRCm39) probably null Het
Fzd8 T G 18: 9,213,797 (GRCm39) V293G probably damaging Het
Gm4787 T A 12: 81,424,925 (GRCm39) H411L probably benign Het
Gm49380 G T 9: 44,023,269 (GRCm39) D326E probably benign Het
Hcrtr1 G A 4: 130,029,083 (GRCm39) R240C probably damaging Het
Hdac5 A T 11: 102,088,181 (GRCm39) Y948N probably damaging Het
Hepacam A G 9: 37,295,167 (GRCm39) S301G probably benign Het
Htra4 A T 8: 25,520,574 (GRCm39) D362E possibly damaging Het
Ighv1-9 G A 12: 114,547,361 (GRCm39) P60L probably damaging Het
Kcnq3 A G 15: 65,867,390 (GRCm39) I751T probably damaging Het
Magi3 T C 3: 103,941,402 (GRCm39) Y851C probably damaging Het
Mefv A G 16: 3,531,499 (GRCm39) S470P probably benign Het
Mfsd2a C T 4: 122,843,091 (GRCm39) V397I probably benign Het
Mroh1 C A 15: 76,318,073 (GRCm39) H867N probably benign Het
Mthfd1l C T 10: 3,957,745 (GRCm39) R261* probably null Het
Myo3a A G 2: 22,412,157 (GRCm39) I725M probably damaging Het
Neb T C 2: 52,099,552 (GRCm39) D4766G possibly damaging Het
Nek11 G T 9: 105,270,156 (GRCm39) P22Q probably damaging Het
Or4p18 T C 2: 88,232,457 (GRCm39) T274A possibly damaging Het
Or5k15 T C 16: 58,709,948 (GRCm39) T212A probably benign Het
Or9q2 A T 19: 13,772,603 (GRCm39) V124E possibly damaging Het
Peg10 C G 6: 4,756,113 (GRCm39) Q230E unknown Het
Pipox T C 11: 77,774,735 (GRCm39) D116G probably benign Het
Pkd1l2 C T 8: 117,774,236 (GRCm39) R993H probably benign Het
Pkdrej A C 15: 85,702,611 (GRCm39) N1108K probably damaging Het
Polr2a C T 11: 69,637,202 (GRCm39) R291Q probably benign Het
Pomt1 T A 2: 32,134,309 (GRCm39) Y277N probably damaging Het
Rasal2 A G 1: 157,126,805 (GRCm39) S78P probably damaging Het
Rgl1 A T 1: 152,433,252 (GRCm39) L171Q probably damaging Het
Sfta2 A G 17: 35,912,666 (GRCm39) E14G unknown Het
Slc37a1 A T 17: 31,541,233 (GRCm39) I242F probably damaging Het
Srfbp1 T A 18: 52,621,762 (GRCm39) D274E probably damaging Het
Syne2 T A 12: 75,959,127 (GRCm39) S685R possibly damaging Het
Tenm4 A C 7: 96,544,383 (GRCm39) D2170A probably damaging Het
Tnr A G 1: 159,691,265 (GRCm39) T472A probably damaging Het
Tspan9 T C 6: 127,942,241 (GRCm39) H203R probably damaging Het
Ttn T C 2: 76,601,995 (GRCm39) T18556A possibly damaging Het
Usp25 T A 16: 76,868,569 (GRCm39) Y323* probably null Het
Usp31 G T 7: 121,248,249 (GRCm39) R1065S possibly damaging Het
Vmn2r103 A T 17: 20,032,058 (GRCm39) T611S probably damaging Het
Wdfy4 A G 14: 32,864,317 (GRCm39) V552A Het
Zap70 G T 1: 36,810,262 (GRCm39) R124L possibly damaging Het
Zfand6 A T 7: 84,281,957 (GRCm39) S91T possibly damaging Het
Other mutations in Sh3rf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Sh3rf3 APN 10 58,885,178 (GRCm39) missense probably benign 0.06
IGL01898:Sh3rf3 APN 10 58,885,352 (GRCm39) missense probably damaging 0.99
IGL02108:Sh3rf3 APN 10 58,971,650 (GRCm39) missense probably damaging 1.00
IGL02148:Sh3rf3 APN 10 58,922,562 (GRCm39) missense probably benign 0.02
exasperated UTSW 10 58,922,646 (GRCm39) missense probably benign 0.06
strained UTSW 10 58,842,925 (GRCm39) missense probably damaging 1.00
R0421:Sh3rf3 UTSW 10 58,819,897 (GRCm39) missense probably damaging 1.00
R1056:Sh3rf3 UTSW 10 58,842,904 (GRCm39) missense probably damaging 1.00
R1313:Sh3rf3 UTSW 10 58,907,821 (GRCm39) missense possibly damaging 0.92
R1313:Sh3rf3 UTSW 10 58,907,821 (GRCm39) missense possibly damaging 0.92
R1615:Sh3rf3 UTSW 10 58,966,899 (GRCm39) missense probably benign 0.02
R1797:Sh3rf3 UTSW 10 58,922,489 (GRCm39) nonsense probably null
R1869:Sh3rf3 UTSW 10 58,919,335 (GRCm39) missense probably damaging 1.00
R1924:Sh3rf3 UTSW 10 58,939,989 (GRCm39) splice site probably benign
R1968:Sh3rf3 UTSW 10 58,649,809 (GRCm39) missense probably benign 0.32
R2353:Sh3rf3 UTSW 10 58,842,895 (GRCm39) missense probably damaging 1.00
R3617:Sh3rf3 UTSW 10 58,922,685 (GRCm39) missense possibly damaging 0.83
R3769:Sh3rf3 UTSW 10 58,820,013 (GRCm39) missense probably benign 0.07
R4059:Sh3rf3 UTSW 10 58,919,355 (GRCm39) missense probably damaging 1.00
R4425:Sh3rf3 UTSW 10 58,919,398 (GRCm39) missense probably benign 0.00
R4690:Sh3rf3 UTSW 10 58,649,526 (GRCm39) missense possibly damaging 0.93
R4832:Sh3rf3 UTSW 10 58,649,905 (GRCm39) missense probably benign 0.19
R4853:Sh3rf3 UTSW 10 58,919,341 (GRCm39) missense probably damaging 1.00
R4854:Sh3rf3 UTSW 10 58,649,545 (GRCm39) missense possibly damaging 0.93
R4917:Sh3rf3 UTSW 10 58,842,925 (GRCm39) missense probably damaging 1.00
R4918:Sh3rf3 UTSW 10 58,842,925 (GRCm39) missense probably damaging 1.00
R4995:Sh3rf3 UTSW 10 58,922,646 (GRCm39) missense probably benign 0.06
R5125:Sh3rf3 UTSW 10 58,967,012 (GRCm39) missense probably benign 0.14
R5640:Sh3rf3 UTSW 10 58,649,769 (GRCm39) missense probably benign
R5716:Sh3rf3 UTSW 10 58,967,105 (GRCm39) missense probably benign 0.03
R5756:Sh3rf3 UTSW 10 58,940,204 (GRCm39) missense probably damaging 0.98
R5848:Sh3rf3 UTSW 10 58,819,975 (GRCm39) missense possibly damaging 0.54
R5908:Sh3rf3 UTSW 10 58,885,270 (GRCm39) missense probably benign 0.32
R5930:Sh3rf3 UTSW 10 58,966,808 (GRCm39) missense probably damaging 1.00
R6036:Sh3rf3 UTSW 10 58,649,806 (GRCm39) missense probably benign 0.19
R6036:Sh3rf3 UTSW 10 58,649,806 (GRCm39) missense probably benign 0.19
R6392:Sh3rf3 UTSW 10 58,842,898 (GRCm39) missense probably damaging 0.97
R6450:Sh3rf3 UTSW 10 58,819,966 (GRCm39) missense probably damaging 1.00
R6470:Sh3rf3 UTSW 10 58,819,791 (GRCm39) missense probably damaging 1.00
R6639:Sh3rf3 UTSW 10 58,919,289 (GRCm39) missense probably damaging 1.00
R6685:Sh3rf3 UTSW 10 58,922,663 (GRCm39) missense possibly damaging 0.95
R7292:Sh3rf3 UTSW 10 58,907,795 (GRCm39) missense probably damaging 1.00
R7789:Sh3rf3 UTSW 10 58,922,637 (GRCm39) missense probably benign 0.01
R7941:Sh3rf3 UTSW 10 58,842,883 (GRCm39) missense probably damaging 0.99
R7959:Sh3rf3 UTSW 10 58,842,925 (GRCm39) missense probably damaging 1.00
R8142:Sh3rf3 UTSW 10 58,885,205 (GRCm39) nonsense probably null
R8241:Sh3rf3 UTSW 10 58,940,242 (GRCm39) missense probably benign 0.11
R8406:Sh3rf3 UTSW 10 58,919,407 (GRCm39) missense probably damaging 1.00
R8725:Sh3rf3 UTSW 10 58,939,992 (GRCm39) critical splice acceptor site probably null
R8727:Sh3rf3 UTSW 10 58,939,992 (GRCm39) critical splice acceptor site probably null
R9341:Sh3rf3 UTSW 10 58,966,802 (GRCm39) missense probably damaging 0.99
R9343:Sh3rf3 UTSW 10 58,966,802 (GRCm39) missense probably damaging 0.99
RF020:Sh3rf3 UTSW 10 58,649,590 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTCCATGTGTGAGCTCCGG -3'
(R):5'- AATTACCTGGGTGGGGACAG -3'

Sequencing Primer
(F):5'- ATGTGTGAGCTCCGGACAGG -3'
(R):5'- AAGCTCCCCAATCCTGGCTG -3'
Posted On 2020-06-30