Mutagenetix > Incidental Mutation

Incidental Mutation 'R8140:Polr2a'

632490

Institutional Source

Beutler Lab

Gene Symbol

Polr2a

Ensembl Gene

ENSMUSG00000005198

Gene Name

polymerase (RNA) II (DNA directed) polypeptide A

Synonyms

Rpo2-1, 220kDa

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R8140 (G1)

Quality Score

181.009

Status

Validated

Chromosome

Chromosomal Location

69733997-69758637 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 69746376 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 291 (R291Q)

Ref Sequence

ENSEMBL: ENSMUSP00000050771 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058470] [ENSMUST00000071213]

AlphaFold

P08775

Predicted Effect

probably benign
Transcript: ENSMUST00000058470
AA Change: R291Q

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000050771
Gene: ENSMUSG00000005198
AA Change: R291Q

Domain	Start	End	E-Value	Type
Blast:RPOLA_N	110	179	5e-37	BLAST
RPOLA_N	246	549	7.02e-203	SMART
Pfam:RNA_pol_Rpb1_4	716	823	3.6e-39	PFAM
Pfam:RNA_pol_Rpb1_5	830	1428	2e-101	PFAM
Pfam:RNA_pol_Rpb1_6	896	1079	1.7e-70	PFAM
Pfam:RNA_pol_Rpb1_7	1164	1299	1.7e-57	PFAM
Pfam:RNA_pol_Rpb1_R	1555	1568	2.1e-3	PFAM
Pfam:RNA_pol_Rpb1_R	1616	1629	8.8e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1630	1643	1.9e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1644	1657	2.3e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1658	1671	2.2e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1672	1685	2.4e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1686	1699	2.5e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1700	1713	2.5e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1714	1727	2.5e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1728	1741	2.6e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1742	1755	5.3e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1757	1769	5.8e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1784	1797	2.6e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1798	1811	4.8e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1826	1839	4.3e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1841	1853	2e-3	PFAM
Pfam:RNA_pol_Rpb1_R	1854	1867	6.9e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1868	1881	3.7e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1882	1895	1.2e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1896	1909	5e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1910	1923	2.5e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1924	1936	2e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1931	1954	2.6e-3	PFAM
Pfam:RNA_pol_Rpb1_R	1948	1960	2.5e-3	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071213
AA Change: R291Q

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000071200
Gene: ENSMUSG00000005198
AA Change: R291Q

Domain	Start	End	E-Value	Type
Blast:RPOLA_N	110	179	5e-37	BLAST
RPOLA_N	246	549	7.02e-203	SMART
Pfam:RNA_pol_Rpb1_4	716	823	1.8e-41	PFAM
Pfam:RNA_pol_Rpb1_5	830	1428	4.8e-104	PFAM
Pfam:RNA_pol_Rpb1_6	896	1079	5.2e-74	PFAM
Pfam:RNA_pol_Rpb1_7	1164	1299	1.4e-55	PFAM
low complexity region	1503	1522	N/A	INTRINSIC
low complexity region	1524	1549	N/A	INTRINSIC
Pfam:RNA_pol_Rpb1_R	1578	1591	2.7e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1592	1605	2.5e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1606	1619	2.7e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1620	1633	2.5e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1634	1647	2.5e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1648	1661	2.4e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1662	1675	2.4e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1676	1689	2.6e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1690	1703	2.3e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1704	1717	5.2e-7	PFAM
Pfam:RNA_pol_Rpb1_R	1718	1731	5.5e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1732	1745	1.6e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1746	1759	8.6e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1760	1773	2e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1788	1801	3.3e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1802	1815	2.4e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1816	1829	8.3e-7	PFAM
Pfam:RNA_pol_Rpb1_R	1830	1843	2.2e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1844	1857	1.6e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1858	1871	2.8e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1872	1885	6e-7	PFAM
Pfam:RNA_pol_Rpb1_R	1886	1899	4.6e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1893	1909	4.8e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1903	1916	2.8e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1910	1923	1.6e-4	PFAM

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 93.9%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The product of this gene contains a carboxy terminal domain composed of heptapeptide repeats that are essential for polymerase activity. These repeats contain serine and threonine residues that are phosphorylated in actively transcribing RNA polymerase. In addition, this subunit, in combination with several other polymerase subunits, forms the DNA binding domain of the polymerase, a groove in which the DNA template is transcribed into RNA. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a reporter allele show prenatal lethality. Homozygotes for a small deletion in the C-terminal domain are viable, fertile and developmentally normal. Homozygotes for a larger deletion show reduced fetal size and partial postnatal lethality; survivors are small but otherwise normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,611	V230E	possibly damaging	Het
Amotl1	G	A	9: 14,572,715		probably null	Het
Atp7b	C	A	8: 22,028,560	E87D	probably damaging	Het
Bcat2	C	T	7: 45,588,351	P347L	probably damaging	Het
Brox	A	T	1: 183,293,873		probably null	Het
Cd37	A	G	7: 45,238,535	I58T	probably damaging	Het
Cep295	A	T	9: 15,341,533	M333K	probably benign	Het
Chtop	A	G	3: 90,505,393		probably null	Het
Cpa2	A	T	6: 30,544,905	K54N	probably benign	Het
Cpa6	A	G	1: 10,325,294	S383P	probably damaging	Het
Dnah7a	A	T	1: 53,501,589	I2542N	probably benign	Het
Eif5b	G	A	1: 38,051,276	V1179I	probably benign	Het
Erbin	T	C	13: 103,920,294		probably null	Het
Fastkd5	A	T	2: 130,615,250	D473E	possibly damaging	Het
Fchsd1	T	C	18: 37,964,342	E372G	probably damaging	Het
Fgl1	T	C	8: 41,200,609		probably null	Het
Fzd8	T	G	18: 9,213,797	V293G	probably damaging	Het
Gm4787	T	A	12: 81,378,151	H411L	probably benign	Het
Gm49380	G	T	9: 44,111,972	D326E	probably benign	Het
Hcrtr1	G	A	4: 130,135,290	R240C	probably damaging	Het
Hdac5	A	T	11: 102,197,355	Y948N	probably damaging	Het
Hepacam	A	G	9: 37,383,871	S301G	probably benign	Het
Htra4	A	T	8: 25,030,558	D362E	possibly damaging	Het
Ighv1-9	G	A	12: 114,583,741	P60L	probably damaging	Het
Kcnq3	A	G	15: 65,995,541	I751T	probably damaging	Het
Magi3	T	C	3: 104,034,086	Y851C	probably damaging	Het
Mefv	A	G	16: 3,713,635	S470P	probably benign	Het
Mfsd2a	C	T	4: 122,949,298	V397I	probably benign	Het
Mroh1	C	A	15: 76,433,873	H867N	probably benign	Het
Mthfd1l	C	T	10: 4,007,745	R261*	probably null	Het
Myo3a	A	G	2: 22,407,346	I725M	probably damaging	Het
Neb	T	C	2: 52,209,540	D4766G	possibly damaging	Het
Nek11	G	T	9: 105,392,957	P22Q	probably damaging	Het
Olfr1179	T	C	2: 88,402,113	T274A	possibly damaging	Het
Olfr1497	A	T	19: 13,795,239	V124E	possibly damaging	Het
Olfr178	T	C	16: 58,889,585	T212A	probably benign	Het
Peg10	C	G	6: 4,756,113	Q230E	unknown	Het
Pipox	T	C	11: 77,883,909	D116G	probably benign	Het
Pkd1l2	C	T	8: 117,047,497	R993H	probably benign	Het
Pkdrej	A	C	15: 85,818,410	N1108K	probably damaging	Het
Pomt1	T	A	2: 32,244,297	Y277N	probably damaging	Het
Rasal2	A	G	1: 157,299,235	S78P	probably damaging	Het
Rgl1	A	T	1: 152,557,501	L171Q	probably damaging	Het
Sfta2	A	G	17: 35,601,774	E14G	unknown	Het
Sh3rf3	T	A	10: 59,049,355	S353R	possibly damaging	Het
Slc37a1	A	T	17: 31,322,259	I242F	probably damaging	Het
Srfbp1	T	A	18: 52,488,690	D274E	probably damaging	Het
Syne2	T	A	12: 75,912,353	S685R	possibly damaging	Het
Tenm4	A	C	7: 96,895,176	D2170A	probably damaging	Het
Tnr	A	G	1: 159,863,695	T472A	probably damaging	Het
Tspan9	T	C	6: 127,965,278	H203R	probably damaging	Het
Ttn	T	C	2: 76,771,651	T18556A	possibly damaging	Het
Usp25	T	A	16: 77,071,681	Y323*	probably null	Het
Usp31	G	T	7: 121,649,026	R1065S	possibly damaging	Het
Vmn2r103	A	T	17: 19,811,796	T611S	probably damaging	Het
Wdfy4	A	G	14: 33,142,360	V552A		Het
Zap70	G	T	1: 36,771,181	R124L	possibly damaging	Het
Zfand6	A	T	7: 84,632,749	S91T	possibly damaging	Het

Other mutations in Polr2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00987:Polr2a	APN	11	69743794	splice site	probably benign
IGL01067:Polr2a	APN	11	69748014	missense	possibly damaging	0.94
IGL01547:Polr2a	APN	11	69744942	missense	probably damaging	0.99
IGL01589:Polr2a	APN	11	69741194	missense	probably benign
IGL01955:Polr2a	APN	11	69741848	missense	probably damaging	1.00
IGL02457:Polr2a	APN	11	69743250	splice site	probably benign
IGL02526:Polr2a	APN	11	69739467	missense	probably benign	0.03
IGL02792:Polr2a	APN	11	69746112	missense	probably damaging	0.99
IGL03058:Polr2a	APN	11	69745047	splice site	probably null
IGL03083:Polr2a	APN	11	69745046	critical splice acceptor site	probably null
IGL03198:Polr2a	APN	11	69747281	splice site	probably null
IGL03201:Polr2a	APN	11	69745690	nonsense	probably null
Leastest	UTSW	11	69747292	splice site	probably null
PIT4260001:Polr2a	UTSW	11	69735967	missense	possibly damaging	0.93
R0126:Polr2a	UTSW	11	69747425	missense	probably damaging	0.99
R0254:Polr2a	UTSW	11	69743671	missense	possibly damaging	0.75
R0313:Polr2a	UTSW	11	69735080	missense	unknown
R0336:Polr2a	UTSW	11	69736893	missense	possibly damaging	0.92
R0453:Polr2a	UTSW	11	69741019	missense	possibly damaging	0.65
R0762:Polr2a	UTSW	11	69735117	missense	unknown
R1101:Polr2a	UTSW	11	69748071	missense	probably benign	0.23
R1509:Polr2a	UTSW	11	69747213	missense	possibly damaging	0.93
R1547:Polr2a	UTSW	11	69734555	missense	probably benign	0.39
R1567:Polr2a	UTSW	11	69746031	missense	probably benign	0.07
R1597:Polr2a	UTSW	11	69739929	missense	possibly damaging	0.88
R1614:Polr2a	UTSW	11	69743373	missense	possibly damaging	0.75
R1698:Polr2a	UTSW	11	69739877	critical splice donor site	probably null
R1735:Polr2a	UTSW	11	69742396	missense	probably damaging	0.99
R1743:Polr2a	UTSW	11	69739503	missense	probably damaging	0.96
R1899:Polr2a	UTSW	11	69743946	missense	probably damaging	0.99
R1900:Polr2a	UTSW	11	69743946	missense	probably damaging	0.99
R1931:Polr2a	UTSW	11	69735375	missense	unknown
R2217:Polr2a	UTSW	11	69742685	critical splice donor site	probably null
R2218:Polr2a	UTSW	11	69742685	critical splice donor site	probably null
R2245:Polr2a	UTSW	11	69735183	missense	unknown
R3123:Polr2a	UTSW	11	69735710	missense	possibly damaging	0.92
R3124:Polr2a	UTSW	11	69735710	missense	possibly damaging	0.92
R4018:Polr2a	UTSW	11	69735059	missense	unknown
R4025:Polr2a	UTSW	11	69743659	missense	possibly damaging	0.95
R4197:Polr2a	UTSW	11	69735336	missense	unknown
R4462:Polr2a	UTSW	11	69746403	missense	probably damaging	1.00
R4508:Polr2a	UTSW	11	69742559	critical splice acceptor site	probably null
R4746:Polr2a	UTSW	11	69735674	missense	probably benign	0.05
R5069:Polr2a	UTSW	11	69736735	splice site	probably null
R5102:Polr2a	UTSW	11	69746945	missense	possibly damaging	0.93
R5195:Polr2a	UTSW	11	69744079	missense	probably damaging	1.00
R5234:Polr2a	UTSW	11	69736840	missense	probably benign	0.03
R5330:Polr2a	UTSW	11	69747275	missense	probably benign	0.01
R5331:Polr2a	UTSW	11	69747275	missense	probably benign	0.01
R5896:Polr2a	UTSW	11	69736260	missense	probably damaging	0.99
R5910:Polr2a	UTSW	11	69746870	missense	probably damaging	0.99
R6128:Polr2a	UTSW	11	69736977	missense	probably damaging	1.00
R6238:Polr2a	UTSW	11	69747221	missense	possibly damaging	0.95
R6244:Polr2a	UTSW	11	69744226	missense	probably damaging	1.00
R6303:Polr2a	UTSW	11	69746913	missense	probably damaging	1.00
R6338:Polr2a	UTSW	11	69739679	splice site	probably null
R6361:Polr2a	UTSW	11	69743337	missense	probably damaging	0.99
R6374:Polr2a	UTSW	11	69736932	missense	probably damaging	0.98
R6630:Polr2a	UTSW	11	69735513	missense	possibly damaging	0.93
R6631:Polr2a	UTSW	11	69735513	missense	possibly damaging	0.93
R6633:Polr2a	UTSW	11	69735513	missense	possibly damaging	0.93
R6897:Polr2a	UTSW	11	69735961	missense	probably benign	0.12
R6923:Polr2a	UTSW	11	69735961	missense	probably benign	0.12
R6933:Polr2a	UTSW	11	69736177	missense	probably damaging	0.99
R6933:Polr2a	UTSW	11	69739467	missense	probably benign	0.03
R6953:Polr2a	UTSW	11	69741711	missense	probably damaging	0.99
R6974:Polr2a	UTSW	11	69747200	missense	probably damaging	0.98
R7033:Polr2a	UTSW	11	69747213	missense	possibly damaging	0.93
R7085:Polr2a	UTSW	11	69743880	missense	probably damaging	0.99
R7112:Polr2a	UTSW	11	69735309	missense	unknown
R7124:Polr2a	UTSW	11	69737462	nonsense	probably null
R7307:Polr2a	UTSW	11	69747292	splice site	probably null
R7319:Polr2a	UTSW	11	69746370	missense	possibly damaging	0.95
R7350:Polr2a	UTSW	11	69741060	missense	possibly damaging	0.92
R7369:Polr2a	UTSW	11	69745977	missense	probably benign	0.01
R7585:Polr2a	UTSW	11	69740002	missense	probably damaging	0.99
R7882:Polr2a	UTSW	11	69736174	missense	possibly damaging	0.86
R7935:Polr2a	UTSW	11	69747504	missense	probably benign	0.00
R8080:Polr2a	UTSW	11	69735048	missense	unknown
R8221:Polr2a	UTSW	11	69737518	missense	probably benign	0.24
R8245:Polr2a	UTSW	11	69739953	missense	probably damaging	0.99
R8274:Polr2a	UTSW	11	69748056	missense	probably damaging	0.99
R8275:Polr2a	UTSW	11	69748056	missense	probably damaging	0.99
R8276:Polr2a	UTSW	11	69748056	missense	probably damaging	0.99
R8277:Polr2a	UTSW	11	69748056	missense	probably damaging	0.99
R8311:Polr2a	UTSW	11	69737456	missense	probably null	0.20
R8477:Polr2a	UTSW	11	69735486	missense	probably benign	0.00
R8677:Polr2a	UTSW	11	69735555	missense	possibly damaging	0.85
R8976:Polr2a	UTSW	11	69747211	missense	possibly damaging	0.92
R9296:Polr2a	UTSW	11	69734736	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- CACTCAGGTAGTCAGCACTG -3'
(R):5'- TTGCTCCTTGATAGTTGTGTAACC -3'

Sequencing Primer
(F):5'- AGGTAGTCAGCACTGGTCTCTC -3'
(R):5'- AGTTGTGTAACCTTTAAAGATACCC -3'

Posted On

2020-06-30