Incidental Mutation 'R8140:Polr2a'
ID 632490
Institutional Source Beutler Lab
Gene Symbol Polr2a
Ensembl Gene ENSMUSG00000005198
Gene Name polymerase (RNA) II (DNA directed) polypeptide A
Synonyms Rpo2-1, 220kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock # R8140 (G1)
Quality Score 181.009
Status Validated
Chromosome 11
Chromosomal Location 69733997-69758637 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 69746376 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 291 (R291Q)
Ref Sequence ENSEMBL: ENSMUSP00000050771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058470] [ENSMUST00000071213]
AlphaFold P08775
Predicted Effect probably benign
Transcript: ENSMUST00000058470
AA Change: R291Q

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000050771
Gene: ENSMUSG00000005198
AA Change: R291Q

DomainStartEndE-ValueType
Blast:RPOLA_N 110 179 5e-37 BLAST
RPOLA_N 246 549 7.02e-203 SMART
Pfam:RNA_pol_Rpb1_4 716 823 3.6e-39 PFAM
Pfam:RNA_pol_Rpb1_5 830 1428 2e-101 PFAM
Pfam:RNA_pol_Rpb1_6 896 1079 1.7e-70 PFAM
Pfam:RNA_pol_Rpb1_7 1164 1299 1.7e-57 PFAM
Pfam:RNA_pol_Rpb1_R 1555 1568 2.1e-3 PFAM
Pfam:RNA_pol_Rpb1_R 1616 1629 8.8e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1630 1643 1.9e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1644 1657 2.3e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1658 1671 2.2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1672 1685 2.4e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1686 1699 2.5e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1700 1713 2.5e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1714 1727 2.5e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1728 1741 2.6e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1742 1755 5.3e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1757 1769 5.8e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1784 1797 2.6e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1798 1811 4.8e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1826 1839 4.3e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1841 1853 2e-3 PFAM
Pfam:RNA_pol_Rpb1_R 1854 1867 6.9e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1868 1881 3.7e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1882 1895 1.2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1896 1909 5e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1910 1923 2.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1924 1936 2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1931 1954 2.6e-3 PFAM
Pfam:RNA_pol_Rpb1_R 1948 1960 2.5e-3 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000071213
AA Change: R291Q

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071200
Gene: ENSMUSG00000005198
AA Change: R291Q

DomainStartEndE-ValueType
Blast:RPOLA_N 110 179 5e-37 BLAST
RPOLA_N 246 549 7.02e-203 SMART
Pfam:RNA_pol_Rpb1_4 716 823 1.8e-41 PFAM
Pfam:RNA_pol_Rpb1_5 830 1428 4.8e-104 PFAM
Pfam:RNA_pol_Rpb1_6 896 1079 5.2e-74 PFAM
Pfam:RNA_pol_Rpb1_7 1164 1299 1.4e-55 PFAM
low complexity region 1503 1522 N/A INTRINSIC
low complexity region 1524 1549 N/A INTRINSIC
Pfam:RNA_pol_Rpb1_R 1578 1591 2.7e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1592 1605 2.5e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1606 1619 2.7e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1620 1633 2.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1634 1647 2.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1648 1661 2.4e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1662 1675 2.4e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1676 1689 2.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1690 1703 2.3e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1704 1717 5.2e-7 PFAM
Pfam:RNA_pol_Rpb1_R 1718 1731 5.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1732 1745 1.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1746 1759 8.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1760 1773 2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1788 1801 3.3e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1802 1815 2.4e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1816 1829 8.3e-7 PFAM
Pfam:RNA_pol_Rpb1_R 1830 1843 2.2e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1844 1857 1.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1858 1871 2.8e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1872 1885 6e-7 PFAM
Pfam:RNA_pol_Rpb1_R 1886 1899 4.6e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1893 1909 4.8e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1903 1916 2.8e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1910 1923 1.6e-4 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The product of this gene contains a carboxy terminal domain composed of heptapeptide repeats that are essential for polymerase activity. These repeats contain serine and threonine residues that are phosphorylated in actively transcribing RNA polymerase. In addition, this subunit, in combination with several other polymerase subunits, forms the DNA binding domain of the polymerase, a groove in which the DNA template is transcribed into RNA. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a reporter allele show prenatal lethality. Homozygotes for a small deletion in the C-terminal domain are viable, fertile and developmentally normal. Homozygotes for a larger deletion show reduced fetal size and partial postnatal lethality; survivors are small but otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,611 V230E possibly damaging Het
Amotl1 G A 9: 14,572,715 probably null Het
Atp7b C A 8: 22,028,560 E87D probably damaging Het
Bcat2 C T 7: 45,588,351 P347L probably damaging Het
Brox A T 1: 183,293,873 probably null Het
Cd37 A G 7: 45,238,535 I58T probably damaging Het
Cep295 A T 9: 15,341,533 M333K probably benign Het
Chtop A G 3: 90,505,393 probably null Het
Cpa2 A T 6: 30,544,905 K54N probably benign Het
Cpa6 A G 1: 10,325,294 S383P probably damaging Het
Dnah7a A T 1: 53,501,589 I2542N probably benign Het
Eif5b G A 1: 38,051,276 V1179I probably benign Het
Erbin T C 13: 103,920,294 probably null Het
Fastkd5 A T 2: 130,615,250 D473E possibly damaging Het
Fchsd1 T C 18: 37,964,342 E372G probably damaging Het
Fgl1 T C 8: 41,200,609 probably null Het
Fzd8 T G 18: 9,213,797 V293G probably damaging Het
Gm4787 T A 12: 81,378,151 H411L probably benign Het
Gm49380 G T 9: 44,111,972 D326E probably benign Het
Hcrtr1 G A 4: 130,135,290 R240C probably damaging Het
Hdac5 A T 11: 102,197,355 Y948N probably damaging Het
Hepacam A G 9: 37,383,871 S301G probably benign Het
Htra4 A T 8: 25,030,558 D362E possibly damaging Het
Ighv1-9 G A 12: 114,583,741 P60L probably damaging Het
Kcnq3 A G 15: 65,995,541 I751T probably damaging Het
Magi3 T C 3: 104,034,086 Y851C probably damaging Het
Mefv A G 16: 3,713,635 S470P probably benign Het
Mfsd2a C T 4: 122,949,298 V397I probably benign Het
Mroh1 C A 15: 76,433,873 H867N probably benign Het
Mthfd1l C T 10: 4,007,745 R261* probably null Het
Myo3a A G 2: 22,407,346 I725M probably damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nek11 G T 9: 105,392,957 P22Q probably damaging Het
Olfr1179 T C 2: 88,402,113 T274A possibly damaging Het
Olfr1497 A T 19: 13,795,239 V124E possibly damaging Het
Olfr178 T C 16: 58,889,585 T212A probably benign Het
Peg10 C G 6: 4,756,113 Q230E unknown Het
Pipox T C 11: 77,883,909 D116G probably benign Het
Pkd1l2 C T 8: 117,047,497 R993H probably benign Het
Pkdrej A C 15: 85,818,410 N1108K probably damaging Het
Pomt1 T A 2: 32,244,297 Y277N probably damaging Het
Rasal2 A G 1: 157,299,235 S78P probably damaging Het
Rgl1 A T 1: 152,557,501 L171Q probably damaging Het
Sfta2 A G 17: 35,601,774 E14G unknown Het
Sh3rf3 T A 10: 59,049,355 S353R possibly damaging Het
Slc37a1 A T 17: 31,322,259 I242F probably damaging Het
Srfbp1 T A 18: 52,488,690 D274E probably damaging Het
Syne2 T A 12: 75,912,353 S685R possibly damaging Het
Tenm4 A C 7: 96,895,176 D2170A probably damaging Het
Tnr A G 1: 159,863,695 T472A probably damaging Het
Tspan9 T C 6: 127,965,278 H203R probably damaging Het
Ttn T C 2: 76,771,651 T18556A possibly damaging Het
Usp25 T A 16: 77,071,681 Y323* probably null Het
Usp31 G T 7: 121,649,026 R1065S possibly damaging Het
Vmn2r103 A T 17: 19,811,796 T611S probably damaging Het
Wdfy4 A G 14: 33,142,360 V552A Het
Zap70 G T 1: 36,771,181 R124L possibly damaging Het
Zfand6 A T 7: 84,632,749 S91T possibly damaging Het
Other mutations in Polr2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Polr2a APN 11 69743794 splice site probably benign
IGL01067:Polr2a APN 11 69748014 missense possibly damaging 0.94
IGL01547:Polr2a APN 11 69744942 missense probably damaging 0.99
IGL01589:Polr2a APN 11 69741194 missense probably benign
IGL01955:Polr2a APN 11 69741848 missense probably damaging 1.00
IGL02457:Polr2a APN 11 69743250 splice site probably benign
IGL02526:Polr2a APN 11 69739467 missense probably benign 0.03
IGL02792:Polr2a APN 11 69746112 missense probably damaging 0.99
IGL03058:Polr2a APN 11 69745047 splice site probably null
IGL03083:Polr2a APN 11 69745046 critical splice acceptor site probably null
IGL03198:Polr2a APN 11 69747281 splice site probably null
IGL03201:Polr2a APN 11 69745690 nonsense probably null
Leastest UTSW 11 69747292 splice site probably null
PIT4260001:Polr2a UTSW 11 69735967 missense possibly damaging 0.93
R0126:Polr2a UTSW 11 69747425 missense probably damaging 0.99
R0254:Polr2a UTSW 11 69743671 missense possibly damaging 0.75
R0313:Polr2a UTSW 11 69735080 missense unknown
R0336:Polr2a UTSW 11 69736893 missense possibly damaging 0.92
R0453:Polr2a UTSW 11 69741019 missense possibly damaging 0.65
R0762:Polr2a UTSW 11 69735117 missense unknown
R1101:Polr2a UTSW 11 69748071 missense probably benign 0.23
R1509:Polr2a UTSW 11 69747213 missense possibly damaging 0.93
R1547:Polr2a UTSW 11 69734555 missense probably benign 0.39
R1567:Polr2a UTSW 11 69746031 missense probably benign 0.07
R1597:Polr2a UTSW 11 69739929 missense possibly damaging 0.88
R1614:Polr2a UTSW 11 69743373 missense possibly damaging 0.75
R1698:Polr2a UTSW 11 69739877 critical splice donor site probably null
R1735:Polr2a UTSW 11 69742396 missense probably damaging 0.99
R1743:Polr2a UTSW 11 69739503 missense probably damaging 0.96
R1899:Polr2a UTSW 11 69743946 missense probably damaging 0.99
R1900:Polr2a UTSW 11 69743946 missense probably damaging 0.99
R1931:Polr2a UTSW 11 69735375 missense unknown
R2217:Polr2a UTSW 11 69742685 critical splice donor site probably null
R2218:Polr2a UTSW 11 69742685 critical splice donor site probably null
R2245:Polr2a UTSW 11 69735183 missense unknown
R3123:Polr2a UTSW 11 69735710 missense possibly damaging 0.92
R3124:Polr2a UTSW 11 69735710 missense possibly damaging 0.92
R4018:Polr2a UTSW 11 69735059 missense unknown
R4025:Polr2a UTSW 11 69743659 missense possibly damaging 0.95
R4197:Polr2a UTSW 11 69735336 missense unknown
R4462:Polr2a UTSW 11 69746403 missense probably damaging 1.00
R4508:Polr2a UTSW 11 69742559 critical splice acceptor site probably null
R4746:Polr2a UTSW 11 69735674 missense probably benign 0.05
R5069:Polr2a UTSW 11 69736735 splice site probably null
R5102:Polr2a UTSW 11 69746945 missense possibly damaging 0.93
R5195:Polr2a UTSW 11 69744079 missense probably damaging 1.00
R5234:Polr2a UTSW 11 69736840 missense probably benign 0.03
R5330:Polr2a UTSW 11 69747275 missense probably benign 0.01
R5331:Polr2a UTSW 11 69747275 missense probably benign 0.01
R5896:Polr2a UTSW 11 69736260 missense probably damaging 0.99
R5910:Polr2a UTSW 11 69746870 missense probably damaging 0.99
R6128:Polr2a UTSW 11 69736977 missense probably damaging 1.00
R6238:Polr2a UTSW 11 69747221 missense possibly damaging 0.95
R6244:Polr2a UTSW 11 69744226 missense probably damaging 1.00
R6303:Polr2a UTSW 11 69746913 missense probably damaging 1.00
R6338:Polr2a UTSW 11 69739679 splice site probably null
R6361:Polr2a UTSW 11 69743337 missense probably damaging 0.99
R6374:Polr2a UTSW 11 69736932 missense probably damaging 0.98
R6630:Polr2a UTSW 11 69735513 missense possibly damaging 0.93
R6631:Polr2a UTSW 11 69735513 missense possibly damaging 0.93
R6633:Polr2a UTSW 11 69735513 missense possibly damaging 0.93
R6897:Polr2a UTSW 11 69735961 missense probably benign 0.12
R6923:Polr2a UTSW 11 69735961 missense probably benign 0.12
R6933:Polr2a UTSW 11 69736177 missense probably damaging 0.99
R6933:Polr2a UTSW 11 69739467 missense probably benign 0.03
R6953:Polr2a UTSW 11 69741711 missense probably damaging 0.99
R6974:Polr2a UTSW 11 69747200 missense probably damaging 0.98
R7033:Polr2a UTSW 11 69747213 missense possibly damaging 0.93
R7085:Polr2a UTSW 11 69743880 missense probably damaging 0.99
R7112:Polr2a UTSW 11 69735309 missense unknown
R7124:Polr2a UTSW 11 69737462 nonsense probably null
R7307:Polr2a UTSW 11 69747292 splice site probably null
R7319:Polr2a UTSW 11 69746370 missense possibly damaging 0.95
R7350:Polr2a UTSW 11 69741060 missense possibly damaging 0.92
R7369:Polr2a UTSW 11 69745977 missense probably benign 0.01
R7585:Polr2a UTSW 11 69740002 missense probably damaging 0.99
R7882:Polr2a UTSW 11 69736174 missense possibly damaging 0.86
R7935:Polr2a UTSW 11 69747504 missense probably benign 0.00
R8080:Polr2a UTSW 11 69735048 missense unknown
R8221:Polr2a UTSW 11 69737518 missense probably benign 0.24
R8245:Polr2a UTSW 11 69739953 missense probably damaging 0.99
R8274:Polr2a UTSW 11 69748056 missense probably damaging 0.99
R8275:Polr2a UTSW 11 69748056 missense probably damaging 0.99
R8276:Polr2a UTSW 11 69748056 missense probably damaging 0.99
R8277:Polr2a UTSW 11 69748056 missense probably damaging 0.99
R8311:Polr2a UTSW 11 69737456 missense probably null 0.20
R8477:Polr2a UTSW 11 69735486 missense probably benign 0.00
R8677:Polr2a UTSW 11 69735555 missense possibly damaging 0.85
R8976:Polr2a UTSW 11 69747211 missense possibly damaging 0.92
R9296:Polr2a UTSW 11 69734736 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CACTCAGGTAGTCAGCACTG -3'
(R):5'- TTGCTCCTTGATAGTTGTGTAACC -3'

Sequencing Primer
(F):5'- AGGTAGTCAGCACTGGTCTCTC -3'
(R):5'- AGTTGTGTAACCTTTAAAGATACCC -3'
Posted On 2020-06-30