Incidental Mutation 'R8140:Kcnq3'
ID 632497
Institutional Source Beutler Lab
Gene Symbol Kcnq3
Ensembl Gene ENSMUSG00000056258
Gene Name potassium voltage-gated channel, subfamily Q, member 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock # R8140 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 65986387-66286642 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65995541 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 751 (I751T)
Ref Sequence ENSEMBL: ENSMUSP00000063380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070256]
AlphaFold Q8K3F6
Predicted Effect probably damaging
Transcript: ENSMUST00000070256
AA Change: I751T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063380
Gene: ENSMUSG00000056258
AA Change: I751T

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
Pfam:Ion_trans 122 364 9.9e-31 PFAM
Pfam:Ion_trans_2 268 357 3.4e-14 PFAM
Pfam:KCNQ_channel 448 658 1.4e-89 PFAM
Pfam:KCNQC3-Ank-G_bd 771 867 3.8e-41 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the regulation of neuronal excitability. The encoded protein forms an M-channel by associating with the products of the related KCNQ2 or KCNQ5 genes, which both encode integral membrane proteins. M-channel currents are inhibited by M1 muscarinic acetylcholine receptors and are activated by retigabine, a novel anti-convulsant drug. Defects in this gene are a cause of benign familial neonatal convulsions type 2 (BFNC2), also known as epilepsy, benign neonatal type 2 (EBN2). Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal apamin-insensitive afterhyperpolarization currents in granule cells, but not pyramidal cells, of the hippocampus. Mice homozygous for a knock-in allele exhibit spontaneous seizures and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,611 V230E possibly damaging Het
Amotl1 G A 9: 14,572,715 probably null Het
Atp7b C A 8: 22,028,560 E87D probably damaging Het
Bcat2 C T 7: 45,588,351 P347L probably damaging Het
Brox A T 1: 183,293,873 probably null Het
Cd37 A G 7: 45,238,535 I58T probably damaging Het
Cep295 A T 9: 15,341,533 M333K probably benign Het
Chtop A G 3: 90,505,393 probably null Het
Cpa2 A T 6: 30,544,905 K54N probably benign Het
Cpa6 A G 1: 10,325,294 S383P probably damaging Het
Dnah7a A T 1: 53,501,589 I2542N probably benign Het
Eif5b G A 1: 38,051,276 V1179I probably benign Het
Erbin T C 13: 103,920,294 probably null Het
Fastkd5 A T 2: 130,615,250 D473E possibly damaging Het
Fchsd1 T C 18: 37,964,342 E372G probably damaging Het
Fgl1 T C 8: 41,200,609 probably null Het
Fzd8 T G 18: 9,213,797 V293G probably damaging Het
Gm4787 T A 12: 81,378,151 H411L probably benign Het
Gm49380 G T 9: 44,111,972 D326E probably benign Het
Hcrtr1 G A 4: 130,135,290 R240C probably damaging Het
Hdac5 A T 11: 102,197,355 Y948N probably damaging Het
Hepacam A G 9: 37,383,871 S301G probably benign Het
Htra4 A T 8: 25,030,558 D362E possibly damaging Het
Ighv1-9 G A 12: 114,583,741 P60L probably damaging Het
Magi3 T C 3: 104,034,086 Y851C probably damaging Het
Mefv A G 16: 3,713,635 S470P probably benign Het
Mfsd2a C T 4: 122,949,298 V397I probably benign Het
Mroh1 C A 15: 76,433,873 H867N probably benign Het
Mthfd1l C T 10: 4,007,745 R261* probably null Het
Myo3a A G 2: 22,407,346 I725M probably damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nek11 G T 9: 105,392,957 P22Q probably damaging Het
Olfr1179 T C 2: 88,402,113 T274A possibly damaging Het
Olfr1497 A T 19: 13,795,239 V124E possibly damaging Het
Olfr178 T C 16: 58,889,585 T212A probably benign Het
Peg10 C G 6: 4,756,113 Q230E unknown Het
Pipox T C 11: 77,883,909 D116G probably benign Het
Pkd1l2 C T 8: 117,047,497 R993H probably benign Het
Pkdrej A C 15: 85,818,410 N1108K probably damaging Het
Polr2a C T 11: 69,746,376 R291Q probably benign Het
Pomt1 T A 2: 32,244,297 Y277N probably damaging Het
Rasal2 A G 1: 157,299,235 S78P probably damaging Het
Rgl1 A T 1: 152,557,501 L171Q probably damaging Het
Sfta2 A G 17: 35,601,774 E14G unknown Het
Sh3rf3 T A 10: 59,049,355 S353R possibly damaging Het
Slc37a1 A T 17: 31,322,259 I242F probably damaging Het
Srfbp1 T A 18: 52,488,690 D274E probably damaging Het
Syne2 T A 12: 75,912,353 S685R possibly damaging Het
Tenm4 A C 7: 96,895,176 D2170A probably damaging Het
Tnr A G 1: 159,863,695 T472A probably damaging Het
Tspan9 T C 6: 127,965,278 H203R probably damaging Het
Ttn T C 2: 76,771,651 T18556A possibly damaging Het
Usp25 T A 16: 77,071,681 Y323* probably null Het
Usp31 G T 7: 121,649,026 R1065S possibly damaging Het
Vmn2r103 A T 17: 19,811,796 T611S probably damaging Het
Wdfy4 A G 14: 33,142,360 V552A Het
Zap70 G T 1: 36,771,181 R124L possibly damaging Het
Zfand6 A T 7: 84,632,749 S91T possibly damaging Het
Other mutations in Kcnq3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Kcnq3 APN 15 65995271 missense probably damaging 1.00
IGL00808:Kcnq3 APN 15 65995754 missense possibly damaging 0.49
IGL00969:Kcnq3 APN 15 66004726 missense probably damaging 1.00
IGL01121:Kcnq3 APN 15 66005977 splice site probably benign
IGL01996:Kcnq3 APN 15 66023696 missense probably damaging 0.98
IGL02153:Kcnq3 APN 15 66025191 missense probably damaging 0.96
IGL02950:Kcnq3 APN 15 66020293 missense probably benign 0.12
IGL02963:Kcnq3 APN 15 66285826 splice site probably benign
IGL03102:Kcnq3 APN 15 66028788 missense probably damaging 1.00
IGL03050:Kcnq3 UTSW 15 66025178 missense possibly damaging 0.52
R0345:Kcnq3 UTSW 15 66020305 missense possibly damaging 0.55
R0388:Kcnq3 UTSW 15 66000038 missense probably benign 0.00
R0730:Kcnq3 UTSW 15 65995608 missense probably benign
R1173:Kcnq3 UTSW 15 66000042 missense probably benign 0.01
R1610:Kcnq3 UTSW 15 66025260 missense probably damaging 1.00
R1678:Kcnq3 UTSW 15 66031432 missense probably damaging 1.00
R1714:Kcnq3 UTSW 15 66000063 missense probably benign 0.21
R1755:Kcnq3 UTSW 15 65995421 missense probably damaging 1.00
R1768:Kcnq3 UTSW 15 66005906 missense probably damaging 0.98
R1873:Kcnq3 UTSW 15 66002255 missense probably benign 0.16
R1925:Kcnq3 UTSW 15 66004809 missense possibly damaging 0.75
R1970:Kcnq3 UTSW 15 66028623 critical splice donor site probably null
R2140:Kcnq3 UTSW 15 66005978 splice site probably benign
R2141:Kcnq3 UTSW 15 65995851 missense probably benign 0.21
R2149:Kcnq3 UTSW 15 66023729 missense probably damaging 1.00
R2212:Kcnq3 UTSW 15 66020293 missense probably benign
R2272:Kcnq3 UTSW 15 66028680 missense probably damaging 1.00
R2566:Kcnq3 UTSW 15 66031427 missense probably damaging 1.00
R2909:Kcnq3 UTSW 15 66025236 missense possibly damaging 0.87
R3703:Kcnq3 UTSW 15 66021739 critical splice donor site probably null
R3704:Kcnq3 UTSW 15 66021739 critical splice donor site probably null
R3899:Kcnq3 UTSW 15 66030523 missense probably benign 0.01
R4096:Kcnq3 UTSW 15 66285815 splice site probably null
R4421:Kcnq3 UTSW 15 65995511 missense probably benign 0.01
R4504:Kcnq3 UTSW 15 65995342 nonsense probably null
R4505:Kcnq3 UTSW 15 65995342 nonsense probably null
R4571:Kcnq3 UTSW 15 66030612 missense probably damaging 1.00
R4577:Kcnq3 UTSW 15 66286214 missense unknown
R4900:Kcnq3 UTSW 15 65995410 missense probably damaging 1.00
R4981:Kcnq3 UTSW 15 66031405 missense possibly damaging 0.84
R5015:Kcnq3 UTSW 15 66004763 missense probably damaging 1.00
R5049:Kcnq3 UTSW 15 66285897 missense probably benign 0.17
R5245:Kcnq3 UTSW 15 66031435 missense possibly damaging 0.89
R5334:Kcnq3 UTSW 15 66025224 missense probably damaging 1.00
R5528:Kcnq3 UTSW 15 66025178 missense probably damaging 0.97
R5532:Kcnq3 UTSW 15 65997773 nonsense probably null
R5630:Kcnq3 UTSW 15 66025122 missense probably damaging 1.00
R5639:Kcnq3 UTSW 15 65997750 missense probably damaging 0.96
R5936:Kcnq3 UTSW 15 66000110 missense probably damaging 1.00
R6306:Kcnq3 UTSW 15 66004794 missense probably benign 0.40
R6576:Kcnq3 UTSW 15 66025178 missense possibly damaging 0.52
R7006:Kcnq3 UTSW 15 66020316 nonsense probably null
R7403:Kcnq3 UTSW 15 66002217 missense probably damaging 1.00
R9189:Kcnq3 UTSW 15 65995661 missense probably damaging 1.00
RF045:Kcnq3 UTSW 15 66286184 small deletion probably benign
X0060:Kcnq3 UTSW 15 66031386 missense probably damaging 1.00
Z1177:Kcnq3 UTSW 15 65995452 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TGCTGAAGCCACTTGGAGAC -3'
(R):5'- CAACAGGTACTCTGATTTGAAAACC -3'

Sequencing Primer
(F):5'- AAGCCACTTGGAGACCGCTC -3'
(R):5'- TCTGCAACTACTCAGAGACAGGG -3'
Posted On 2020-06-30