Incidental Mutation 'R8140:Mroh1'
ID632498
Institutional Source Beutler Lab
Gene Symbol Mroh1
Ensembl Gene ENSMUSG00000022558
Gene Namemaestro heat-like repeat family member 1
SynonymsHeatr7a, D330001F17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R8140 (G1)
Quality Score171.009
Status Validated
Chromosome15
Chromosomal Location76380261-76453038 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 76433873 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 867 (H867N)
Ref Sequence ENSEMBL: ENSMUSP00000094115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092595] [ENSMUST00000096385] [ENSMUST00000161305]
Predicted Effect probably benign
Transcript: ENSMUST00000092595
AA Change: H858N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000090256
Gene: ENSMUSG00000022558
AA Change: H858N

DomainStartEndE-ValueType
SCOP:d1gw5a_ 4 435 4e-10 SMART
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 926 937 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096385
AA Change: H867N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000094115
Gene: ENSMUSG00000022558
AA Change: H867N

DomainStartEndE-ValueType
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 799 810 N/A INTRINSIC
low complexity region 935 946 N/A INTRINSIC
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1488 1502 N/A INTRINSIC
Pfam:HEAT 1610 1640 2.2e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161305
AA Change: H858N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,611 V230E possibly damaging Het
Amotl1 G A 9: 14,572,715 probably null Het
Atp7b C A 8: 22,028,560 E87D probably damaging Het
Bcat2 C T 7: 45,588,351 P347L probably damaging Het
Brox A T 1: 183,293,873 probably null Het
Cd37 A G 7: 45,238,535 I58T probably damaging Het
Cep295 A T 9: 15,341,533 M333K probably benign Het
Chtop A G 3: 90,505,393 probably null Het
Cpa2 A T 6: 30,544,905 K54N probably benign Het
Cpa6 A G 1: 10,325,294 S383P probably damaging Het
Dnah7a A T 1: 53,501,589 I2542N probably benign Het
Eif5b G A 1: 38,051,276 V1179I probably benign Het
Erbin T C 13: 103,920,294 probably null Het
Fastkd5 A T 2: 130,615,250 D473E possibly damaging Het
Fchsd1 T C 18: 37,964,342 E372G probably damaging Het
Fgl1 T C 8: 41,200,609 probably null Het
Fzd8 T G 18: 9,213,797 V293G probably damaging Het
Gm4787 T A 12: 81,378,151 H411L probably benign Het
Gm49380 G T 9: 44,111,972 D326E probably benign Het
Hcrtr1 G A 4: 130,135,290 R240C probably damaging Het
Hdac5 A T 11: 102,197,355 Y948N probably damaging Het
Hepacam A G 9: 37,383,871 S301G probably benign Het
Htra4 A T 8: 25,030,558 D362E possibly damaging Het
Ighv1-9 G A 12: 114,583,741 P60L probably damaging Het
Kcnq3 A G 15: 65,995,541 I751T probably damaging Het
Magi3 T C 3: 104,034,086 Y851C probably damaging Het
Mefv A G 16: 3,713,635 S470P probably benign Het
Mfsd2a C T 4: 122,949,298 V397I probably benign Het
Mthfd1l C T 10: 4,007,745 R261* probably null Het
Myo3a A G 2: 22,407,346 I725M probably damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nek11 G T 9: 105,392,957 P22Q probably damaging Het
Olfr1179 T C 2: 88,402,113 T274A possibly damaging Het
Olfr1497 A T 19: 13,795,239 V124E possibly damaging Het
Olfr178 T C 16: 58,889,585 T212A probably benign Het
Peg10 C G 6: 4,756,113 Q230E unknown Het
Pipox T C 11: 77,883,909 D116G probably benign Het
Pkd1l2 C T 8: 117,047,497 R993H probably benign Het
Pkdrej A C 15: 85,818,410 N1108K probably damaging Het
Polr2a C T 11: 69,746,376 R291Q probably benign Het
Pomt1 T A 2: 32,244,297 Y277N probably damaging Het
Rasal2 A G 1: 157,299,235 S78P probably damaging Het
Rgl1 A T 1: 152,557,501 L171Q probably damaging Het
Sfta2 A G 17: 35,601,774 E14G unknown Het
Sh3rf3 T A 10: 59,049,355 S353R possibly damaging Het
Slc37a1 A T 17: 31,322,259 I242F probably damaging Het
Srfbp1 T A 18: 52,488,690 D274E probably damaging Het
Syne2 T A 12: 75,912,353 S685R possibly damaging Het
Tenm4 A C 7: 96,895,176 D2170A probably damaging Het
Tnr A G 1: 159,863,695 T472A probably damaging Het
Tspan9 T C 6: 127,965,278 H203R probably damaging Het
Ttn T C 2: 76,771,651 T18556A possibly damaging Het
Usp25 T A 16: 77,071,681 Y323* probably null Het
Usp31 G T 7: 121,649,026 R1065S possibly damaging Het
Vmn2r103 A T 17: 19,811,796 T611S probably damaging Het
Wdfy4 A G 14: 33,142,360 V552A Het
Zap70 G T 1: 36,771,181 R124L possibly damaging Het
Zfand6 A T 7: 84,632,749 S91T possibly damaging Het
Other mutations in Mroh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01574:Mroh1 APN 15 76432288 missense probably benign 0.01
IGL02141:Mroh1 APN 15 76446599 missense possibly damaging 0.47
IGL02146:Mroh1 APN 15 76434679 splice site probably benign
IGL02205:Mroh1 APN 15 76437239 missense possibly damaging 0.81
IGL02261:Mroh1 APN 15 76429160 missense probably benign 0.03
IGL02818:Mroh1 APN 15 76432401 splice site probably null
IGL02949:Mroh1 APN 15 76408968 missense probably damaging 0.97
IGL02951:Mroh1 APN 15 76427636 missense probably damaging 1.00
IGL03154:Mroh1 APN 15 76452838 missense probably damaging 1.00
IGL02799:Mroh1 UTSW 15 76392461 critical splice donor site probably null
R0068:Mroh1 UTSW 15 76446692 splice site probably benign
R0068:Mroh1 UTSW 15 76446692 splice site probably benign
R0076:Mroh1 UTSW 15 76451140 missense probably benign 0.00
R0180:Mroh1 UTSW 15 76428250 missense probably damaging 0.99
R0315:Mroh1 UTSW 15 76427600 missense possibly damaging 0.94
R0350:Mroh1 UTSW 15 76432249 missense probably damaging 0.98
R0399:Mroh1 UTSW 15 76452099 missense probably benign 0.44
R0835:Mroh1 UTSW 15 76451883 missense probably damaging 0.96
R0893:Mroh1 UTSW 15 76408938 missense possibly damaging 0.62
R1109:Mroh1 UTSW 15 76446509 splice site probably benign
R1527:Mroh1 UTSW 15 76452263 missense probably benign 0.03
R1595:Mroh1 UTSW 15 76433530 splice site probably benign
R1900:Mroh1 UTSW 15 76433385 missense probably benign 0.00
R1901:Mroh1 UTSW 15 76436049 missense probably benign
R2223:Mroh1 UTSW 15 76408045 critical splice donor site probably null
R2415:Mroh1 UTSW 15 76421211 missense probably damaging 0.99
R3113:Mroh1 UTSW 15 76408536 splice site probably benign
R3437:Mroh1 UTSW 15 76433608 missense possibly damaging 0.92
R3618:Mroh1 UTSW 15 76452346 missense possibly damaging 0.55
R3833:Mroh1 UTSW 15 76401619 missense probably benign 0.08
R4073:Mroh1 UTSW 15 76407985 missense probably benign 0.13
R4156:Mroh1 UTSW 15 76402126 splice site probably null
R4276:Mroh1 UTSW 15 76393851 missense probably damaging 1.00
R4745:Mroh1 UTSW 15 76408530 critical splice donor site probably null
R5450:Mroh1 UTSW 15 76432347 intron probably benign
R5574:Mroh1 UTSW 15 76433931 missense probably benign
R5673:Mroh1 UTSW 15 76430181 missense probably damaging 1.00
R5970:Mroh1 UTSW 15 76451491 missense probably benign 0.24
R5993:Mroh1 UTSW 15 76446680 missense probably damaging 0.99
R6008:Mroh1 UTSW 15 76451357 missense possibly damaging 0.50
R6082:Mroh1 UTSW 15 76430223 missense probably benign 0.06
R6302:Mroh1 UTSW 15 76436119 critical splice donor site probably null
R7030:Mroh1 UTSW 15 76437317 missense probably benign 0.01
R7098:Mroh1 UTSW 15 76408457 nonsense probably null
R7334:Mroh1 UTSW 15 76427638 missense probably benign 0.00
R7337:Mroh1 UTSW 15 76451476 missense probably benign 0.00
R7352:Mroh1 UTSW 15 76451474 missense probably benign 0.06
R7446:Mroh1 UTSW 15 76452272 missense possibly damaging 0.93
R7453:Mroh1 UTSW 15 76433545 missense probably damaging 1.00
R7669:Mroh1 UTSW 15 76451848 missense possibly damaging 0.88
R7753:Mroh1 UTSW 15 76433275 missense possibly damaging 0.62
R7860:Mroh1 UTSW 15 76447332 missense probably benign 0.00
R7990:Mroh1 UTSW 15 76452275 missense probably damaging 1.00
R8325:Mroh1 UTSW 15 76432215 frame shift probably null
R8334:Mroh1 UTSW 15 76446556 missense probably benign
Z1177:Mroh1 UTSW 15 76423761 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCTGAACGTAATGGTAGCTGG -3'
(R):5'- AGTCTTCAAGGGCACACACC -3'

Sequencing Primer
(F):5'- TGGACCATCCATGTAGGCC -3'
(R):5'- TGTCCAGATACAGAGGCTGC -3'
Posted On2020-06-30