Incidental Mutation 'R8140:Mefv'
ID 632500
Institutional Source Beutler Lab
Gene Symbol Mefv
Ensembl Gene ENSMUSG00000022534
Gene Name Mediterranean fever
Synonyms FMF, TRIM20, pyrin, marenostrin
MMRRC Submission 067568-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R8140 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 3525082-3535961 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3531499 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 470 (S470P)
Ref Sequence ENSEMBL: ENSMUSP00000097795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023180] [ENSMUST00000100222] [ENSMUST00000229725]
AlphaFold Q9JJ26
Predicted Effect probably benign
Transcript: ENSMUST00000023180
AA Change: S440P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000023180
Gene: ENSMUSG00000022534
AA Change: S440P

DomainStartEndE-ValueType
PYRIN 5 88 8.89e-32 SMART
BBOX 439 481 4.75e-11 SMART
low complexity region 490 503 N/A INTRINSIC
SCOP:d1f5qb1 519 616 8e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100222
AA Change: S470P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097795
Gene: ENSMUSG00000022534
AA Change: S470P

DomainStartEndE-ValueType
PYRIN 5 88 8.89e-32 SMART
BBOX 469 511 4.75e-11 SMART
low complexity region 520 533 N/A INTRINSIC
SCOP:d1f5qb1 549 646 6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229725
AA Change: S440P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein, also known as pyrin or marenostrin, that is an important modulator of innate immunity. Mutations in this gene are associated with Mediterranean fever, a hereditary periodic fever syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop normally but show increased susceptibilty to infection. Mice homozygous for another knock-out allele exhibit increased macrophage secretion of IL1b and Il18 following stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 64,055,954 (GRCm39) V230E possibly damaging Het
Amotl1 G A 9: 14,484,011 (GRCm39) probably null Het
Atp7b C A 8: 22,518,576 (GRCm39) E87D probably damaging Het
Bcat2 C T 7: 45,237,775 (GRCm39) P347L probably damaging Het
Brox A T 1: 183,075,437 (GRCm39) probably null Het
Cd37 A G 7: 44,887,959 (GRCm39) I58T probably damaging Het
Cep295 A T 9: 15,252,829 (GRCm39) M333K probably benign Het
Chtop A G 3: 90,412,700 (GRCm39) probably null Het
Cpa2 A T 6: 30,544,904 (GRCm39) K54N probably benign Het
Cpa6 A G 1: 10,395,519 (GRCm39) S383P probably damaging Het
Dnah7a A T 1: 53,540,748 (GRCm39) I2542N probably benign Het
Eif5b G A 1: 38,090,357 (GRCm39) V1179I probably benign Het
Erbin T C 13: 104,056,802 (GRCm39) probably null Het
Fastkd5 A T 2: 130,457,170 (GRCm39) D473E possibly damaging Het
Fchsd1 T C 18: 38,097,395 (GRCm39) E372G probably damaging Het
Fgl1 T C 8: 41,653,646 (GRCm39) probably null Het
Fzd8 T G 18: 9,213,797 (GRCm39) V293G probably damaging Het
Gm4787 T A 12: 81,424,925 (GRCm39) H411L probably benign Het
Gm49380 G T 9: 44,023,269 (GRCm39) D326E probably benign Het
Hcrtr1 G A 4: 130,029,083 (GRCm39) R240C probably damaging Het
Hdac5 A T 11: 102,088,181 (GRCm39) Y948N probably damaging Het
Hepacam A G 9: 37,295,167 (GRCm39) S301G probably benign Het
Htra4 A T 8: 25,520,574 (GRCm39) D362E possibly damaging Het
Ighv1-9 G A 12: 114,547,361 (GRCm39) P60L probably damaging Het
Kcnq3 A G 15: 65,867,390 (GRCm39) I751T probably damaging Het
Magi3 T C 3: 103,941,402 (GRCm39) Y851C probably damaging Het
Mfsd2a C T 4: 122,843,091 (GRCm39) V397I probably benign Het
Mroh1 C A 15: 76,318,073 (GRCm39) H867N probably benign Het
Mthfd1l C T 10: 3,957,745 (GRCm39) R261* probably null Het
Myo3a A G 2: 22,412,157 (GRCm39) I725M probably damaging Het
Neb T C 2: 52,099,552 (GRCm39) D4766G possibly damaging Het
Nek11 G T 9: 105,270,156 (GRCm39) P22Q probably damaging Het
Or4p18 T C 2: 88,232,457 (GRCm39) T274A possibly damaging Het
Or5k15 T C 16: 58,709,948 (GRCm39) T212A probably benign Het
Or9q2 A T 19: 13,772,603 (GRCm39) V124E possibly damaging Het
Peg10 C G 6: 4,756,113 (GRCm39) Q230E unknown Het
Pipox T C 11: 77,774,735 (GRCm39) D116G probably benign Het
Pkd1l2 C T 8: 117,774,236 (GRCm39) R993H probably benign Het
Pkdrej A C 15: 85,702,611 (GRCm39) N1108K probably damaging Het
Polr2a C T 11: 69,637,202 (GRCm39) R291Q probably benign Het
Pomt1 T A 2: 32,134,309 (GRCm39) Y277N probably damaging Het
Rasal2 A G 1: 157,126,805 (GRCm39) S78P probably damaging Het
Rgl1 A T 1: 152,433,252 (GRCm39) L171Q probably damaging Het
Sfta2 A G 17: 35,912,666 (GRCm39) E14G unknown Het
Sh3rf3 T A 10: 58,885,177 (GRCm39) S353R possibly damaging Het
Slc37a1 A T 17: 31,541,233 (GRCm39) I242F probably damaging Het
Srfbp1 T A 18: 52,621,762 (GRCm39) D274E probably damaging Het
Syne2 T A 12: 75,959,127 (GRCm39) S685R possibly damaging Het
Tenm4 A C 7: 96,544,383 (GRCm39) D2170A probably damaging Het
Tnr A G 1: 159,691,265 (GRCm39) T472A probably damaging Het
Tspan9 T C 6: 127,942,241 (GRCm39) H203R probably damaging Het
Ttn T C 2: 76,601,995 (GRCm39) T18556A possibly damaging Het
Usp25 T A 16: 76,868,569 (GRCm39) Y323* probably null Het
Usp31 G T 7: 121,248,249 (GRCm39) R1065S possibly damaging Het
Vmn2r103 A T 17: 20,032,058 (GRCm39) T611S probably damaging Het
Wdfy4 A G 14: 32,864,317 (GRCm39) V552A Het
Zap70 G T 1: 36,810,262 (GRCm39) R124L possibly damaging Het
Zfand6 A T 7: 84,281,957 (GRCm39) S91T possibly damaging Het
Other mutations in Mefv
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Mefv APN 16 3,528,824 (GRCm39) missense probably benign 0.01
IGL00583:Mefv APN 16 3,533,936 (GRCm39) nonsense probably null
IGL00963:Mefv APN 16 3,533,584 (GRCm39) missense possibly damaging 0.83
IGL02185:Mefv APN 16 3,533,714 (GRCm39) missense probably benign 0.09
IGL02500:Mefv APN 16 3,531,441 (GRCm39) missense probably damaging 1.00
R0158:Mefv UTSW 16 3,533,320 (GRCm39) missense possibly damaging 0.67
R1312:Mefv UTSW 16 3,526,398 (GRCm39) splice site probably benign
R1793:Mefv UTSW 16 3,526,528 (GRCm39) missense possibly damaging 0.53
R1956:Mefv UTSW 16 3,535,691 (GRCm39) missense probably damaging 1.00
R2169:Mefv UTSW 16 3,528,752 (GRCm39) missense probably benign 0.24
R2973:Mefv UTSW 16 3,533,558 (GRCm39) nonsense probably null
R3723:Mefv UTSW 16 3,526,058 (GRCm39) critical splice donor site probably null
R3724:Mefv UTSW 16 3,526,058 (GRCm39) critical splice donor site probably null
R3953:Mefv UTSW 16 3,533,264 (GRCm39) missense possibly damaging 0.60
R4276:Mefv UTSW 16 3,533,433 (GRCm39) missense probably benign 0.41
R4650:Mefv UTSW 16 3,535,682 (GRCm39) missense probably damaging 1.00
R4651:Mefv UTSW 16 3,535,682 (GRCm39) missense probably damaging 1.00
R4652:Mefv UTSW 16 3,535,682 (GRCm39) missense probably damaging 1.00
R4670:Mefv UTSW 16 3,526,071 (GRCm39) missense possibly damaging 0.67
R4781:Mefv UTSW 16 3,533,198 (GRCm39) missense probably benign 0.00
R5593:Mefv UTSW 16 3,533,315 (GRCm39) missense probably benign 0.00
R5834:Mefv UTSW 16 3,533,910 (GRCm39) missense probably damaging 0.97
R5867:Mefv UTSW 16 3,533,797 (GRCm39) missense probably damaging 1.00
R5954:Mefv UTSW 16 3,533,579 (GRCm39) missense probably benign 0.09
R6056:Mefv UTSW 16 3,525,906 (GRCm39) missense possibly damaging 0.73
R6260:Mefv UTSW 16 3,530,898 (GRCm39) missense probably benign 0.03
R6409:Mefv UTSW 16 3,528,657 (GRCm39) critical splice donor site probably null
R6511:Mefv UTSW 16 3,533,810 (GRCm39) missense probably benign 0.00
R6666:Mefv UTSW 16 3,525,862 (GRCm39) missense possibly damaging 0.88
R6952:Mefv UTSW 16 3,528,744 (GRCm39) missense probably damaging 1.00
R7259:Mefv UTSW 16 3,530,917 (GRCm39) missense probably damaging 1.00
R7410:Mefv UTSW 16 3,533,545 (GRCm39) missense probably damaging 1.00
R7444:Mefv UTSW 16 3,533,386 (GRCm39) missense probably benign 0.21
R8183:Mefv UTSW 16 3,526,446 (GRCm39) missense possibly damaging 0.70
R8279:Mefv UTSW 16 3,533,086 (GRCm39) missense unknown
R8841:Mefv UTSW 16 3,528,842 (GRCm39) missense probably benign 0.02
R8899:Mefv UTSW 16 3,528,764 (GRCm39) missense probably damaging 1.00
R9091:Mefv UTSW 16 3,535,841 (GRCm39) missense probably damaging 1.00
R9270:Mefv UTSW 16 3,535,841 (GRCm39) missense probably damaging 1.00
R9310:Mefv UTSW 16 3,533,252 (GRCm39) missense probably benign 0.00
R9355:Mefv UTSW 16 3,525,882 (GRCm39) missense probably damaging 1.00
R9645:Mefv UTSW 16 3,528,782 (GRCm39) missense probably damaging 1.00
X0064:Mefv UTSW 16 3,528,705 (GRCm39) missense possibly damaging 0.71
Z1176:Mefv UTSW 16 3,533,319 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CAAGGCCAATTCCCAGAGAG -3'
(R):5'- TGTCTCCAGGAAGGTCACAG -3'

Sequencing Primer
(F):5'- GCCAATTCCCAGAGAGAGATG -3'
(R):5'- TCACAGGACAAGGCTGTGTG -3'
Posted On 2020-06-30