Mutagenetix > Incidental Mutations

Incidental Mutation 'R8140:Olfr178'

632501

Institutional Source

Beutler Lab

Gene Symbol

Olfr178

Ensembl Gene

ENSMUSG00000044029

Gene Name

olfactory receptor 178

Synonyms

GA_x54KRFPKG5P-55108059-55107100, MOR184-6

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R8140 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58888308-58892063 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58889585 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 212 (T212A)

Ref Sequence

ENSEMBL: ENSMUSP00000145885 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058564] [ENSMUST00000206523] [ENSMUST00000215032]

AlphaFold

E9Q9T3

Predicted Effect

probably benign
Transcript: ENSMUST00000058564
AA Change: T212A

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000049578
Gene: ENSMUSG00000044029
AA Change: T212A

Domain	Start	End	E-Value	Type
Pfam:7tm_4	33	306	1.2e-49	PFAM
Pfam:7TM_GPCR_Srsx	37	262	4.4e-7	PFAM
Pfam:7tm_1	43	312	5.2e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000206523
AA Change: T212A

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

probably benign
Transcript: ENSMUST00000215032
AA Change: T212A

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 93.9%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,611	V230E	possibly damaging	Het
Amotl1	G	A	9: 14,572,715		probably null	Het
Atp7b	C	A	8: 22,028,560	E87D	probably damaging	Het
Bcat2	C	T	7: 45,588,351	P347L	probably damaging	Het
Brox	A	T	1: 183,293,873		probably null	Het
Cd37	A	G	7: 45,238,535	I58T	probably damaging	Het
Cep295	A	T	9: 15,341,533	M333K	probably benign	Het
Chtop	A	G	3: 90,505,393		probably null	Het
Cpa2	A	T	6: 30,544,905	K54N	probably benign	Het
Cpa6	A	G	1: 10,325,294	S383P	probably damaging	Het
Dnah7a	A	T	1: 53,501,589	I2542N	probably benign	Het
Eif5b	G	A	1: 38,051,276	V1179I	probably benign	Het
Erbin	T	C	13: 103,920,294		probably null	Het
Fastkd5	A	T	2: 130,615,250	D473E	possibly damaging	Het
Fchsd1	T	C	18: 37,964,342	E372G	probably damaging	Het
Fgl1	T	C	8: 41,200,609		probably null	Het
Fzd8	T	G	18: 9,213,797	V293G	probably damaging	Het
Gm4787	T	A	12: 81,378,151	H411L	probably benign	Het
Gm49380	G	T	9: 44,111,972	D326E	probably benign	Het
Hcrtr1	G	A	4: 130,135,290	R240C	probably damaging	Het
Hdac5	A	T	11: 102,197,355	Y948N	probably damaging	Het
Hepacam	A	G	9: 37,383,871	S301G	probably benign	Het
Htra4	A	T	8: 25,030,558	D362E	possibly damaging	Het
Ighv1-9	G	A	12: 114,583,741	P60L	probably damaging	Het
Kcnq3	A	G	15: 65,995,541	I751T	probably damaging	Het
Magi3	T	C	3: 104,034,086	Y851C	probably damaging	Het
Mefv	A	G	16: 3,713,635	S470P	probably benign	Het
Mfsd2a	C	T	4: 122,949,298	V397I	probably benign	Het
Mroh1	C	A	15: 76,433,873	H867N	probably benign	Het
Mthfd1l	C	T	10: 4,007,745	R261*	probably null	Het
Myo3a	A	G	2: 22,407,346	I725M	probably damaging	Het
Neb	T	C	2: 52,209,540	D4766G	possibly damaging	Het
Nek11	G	T	9: 105,392,957	P22Q	probably damaging	Het
Olfr1179	T	C	2: 88,402,113	T274A	possibly damaging	Het
Olfr1497	A	T	19: 13,795,239	V124E	possibly damaging	Het
Peg10	C	G	6: 4,756,113	Q230E	unknown	Het
Pipox	T	C	11: 77,883,909	D116G	probably benign	Het
Pkd1l2	C	T	8: 117,047,497	R993H	probably benign	Het
Pkdrej	A	C	15: 85,818,410	N1108K	probably damaging	Het
Polr2a	C	T	11: 69,746,376	R291Q	probably benign	Het
Pomt1	T	A	2: 32,244,297	Y277N	probably damaging	Het
Rasal2	A	G	1: 157,299,235	S78P	probably damaging	Het
Rgl1	A	T	1: 152,557,501	L171Q	probably damaging	Het
Sfta2	A	G	17: 35,601,774	E14G	unknown	Het
Sh3rf3	T	A	10: 59,049,355	S353R	possibly damaging	Het
Slc37a1	A	T	17: 31,322,259	I242F	probably damaging	Het
Srfbp1	T	A	18: 52,488,690	D274E	probably damaging	Het
Syne2	T	A	12: 75,912,353	S685R	possibly damaging	Het
Tenm4	A	C	7: 96,895,176	D2170A	probably damaging	Het
Tnr	A	G	1: 159,863,695	T472A	probably damaging	Het
Tspan9	T	C	6: 127,965,278	H203R	probably damaging	Het
Ttn	T	C	2: 76,771,651	T18556A	possibly damaging	Het
Usp25	T	A	16: 77,071,681	Y323*	probably null	Het
Usp31	G	T	7: 121,649,026	R1065S	possibly damaging	Het
Vmn2r103	A	T	17: 19,811,796	T611S	probably damaging	Het
Wdfy4	A	G	14: 33,142,360	V552A		Het
Zap70	G	T	1: 36,771,181	R124L	possibly damaging	Het
Zfand6	A	T	7: 84,632,749	S91T	possibly damaging	Het

Other mutations in Olfr178

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00953:Olfr178	APN	16	58889685	missense	probably damaging	0.97
IGL01964:Olfr178	APN	16	58889464	missense	probably damaging	0.97
IGL02122:Olfr178	APN	16	58889771	missense	probably benign
IGL02183:Olfr178	APN	16	58889821	missense	probably benign	0.00
IGL03143:Olfr178	APN	16	58889461	missense	probably damaging	1.00
R1566:Olfr178	UTSW	16	58889540	missense	probably damaging	1.00
R2324:Olfr178	UTSW	16	58890140	missense	probably benign
R2420:Olfr178	UTSW	16	58889965	missense	probably benign	0.00
R2421:Olfr178	UTSW	16	58889965	missense	probably benign	0.00
R2422:Olfr178	UTSW	16	58889965	missense	probably benign	0.00
R4256:Olfr178	UTSW	16	58889780	missense	probably benign	0.21
R4374:Olfr178	UTSW	16	58889879	missense	probably benign	0.13
R4502:Olfr178	UTSW	16	58890176	missense	probably benign	0.02
R4503:Olfr178	UTSW	16	58890176	missense	probably benign	0.02
R4662:Olfr178	UTSW	16	58889924	missense	probably damaging	1.00
R4967:Olfr178	UTSW	16	58889594	missense	possibly damaging	0.48
R5206:Olfr178	UTSW	16	58890018	missense	probably damaging	0.99
R5285:Olfr178	UTSW	16	58890108	nonsense	probably null
R5477:Olfr178	UTSW	16	58889744	missense	probably benign	0.10
R5554:Olfr178	UTSW	16	58889806	missense	possibly damaging	0.95
R5723:Olfr178	UTSW	16	58889613	nonsense	probably null
R5725:Olfr178	UTSW	16	58889887	missense	possibly damaging	0.64
R6853:Olfr178	UTSW	16	58889758	missense	possibly damaging	0.64
R6853:Olfr178	UTSW	16	58889759	missense	probably damaging	0.99
R7238:Olfr178	UTSW	16	58889889	missense	probably damaging	1.00
R7554:Olfr178	UTSW	16	58889406	missense	probably benign	0.27
R7577:Olfr178	UTSW	16	58889266	missense	probably benign	0.22
R7787:Olfr178	UTSW	16	58889590	missense	probably benign
R8008:Olfr178	UTSW	16	58889888	missense	probably benign	0.13
R8928:Olfr178	UTSW	16	58889387	missense	possibly damaging	0.75
R9082:Olfr178	UTSW	16	58889471	missense	probably damaging	1.00
R9285:Olfr178	UTSW	16	58890206	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATGGCCACTGGTATGTCTTTATTAC -3'
(R):5'- TCTCCATTCAGATGAGTATAGGCAC -3'

Sequencing Primer
(F):5'- GGTAGAAAGTGCTTTTCCTCT -3'
(R):5'- TGAGTATAGGCACATTCATAGCCAG -3'

Posted On

2020-06-30