Incidental Mutation 'R8140:Usp25'
ID 632502
Institutional Source Beutler Lab
Gene Symbol Usp25
Ensembl Gene ENSMUSG00000022867
Gene Name ubiquitin specific peptidase 25
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8140 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 77013706-77116780 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 77071681 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 323 (Y323*)
Ref Sequence ENSEMBL: ENSMUSP00000023580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023580]
AlphaFold P57080
PDB Structure Solution Structure of RSGI RUH-013, a UBA domain in Mouse cDNA [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000023580
AA Change: Y323*
SMART Domains Protein: ENSMUSP00000023580
Gene: ENSMUSG00000022867
AA Change: Y323*

DomainStartEndE-ValueType
PDB:1VDL|A 1 67 2e-35 PDB
Blast:UBA 17 56 9e-16 BLAST
UIM 97 116 5.27e-3 SMART
Pfam:UIM 124 140 6.7e-3 PFAM
Pfam:UCH 168 655 9.3e-55 PFAM
Pfam:UCH_1 169 632 3.1e-14 PFAM
coiled coil region 685 714 N/A INTRINSIC
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin (MIM 191339) is a highly conserved 76-amino acid protein involved in regulation of intracellular protein breakdown, cell cycle regulation, and stress response. Ubiquitin is released from degraded proteins by disassembly of the polyubiquitin chains, which is mediated by ubiquitin-specific proteases (USPs), such as USP25 (Valero et al., 1999 [PubMed 10644437]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased severity of IL17-induced pulmonary inflammation and MOG-induced experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,611 V230E possibly damaging Het
Amotl1 G A 9: 14,572,715 probably null Het
Atp7b C A 8: 22,028,560 E87D probably damaging Het
Bcat2 C T 7: 45,588,351 P347L probably damaging Het
Brox A T 1: 183,293,873 probably null Het
Cd37 A G 7: 45,238,535 I58T probably damaging Het
Cep295 A T 9: 15,341,533 M333K probably benign Het
Chtop A G 3: 90,505,393 probably null Het
Cpa2 A T 6: 30,544,905 K54N probably benign Het
Cpa6 A G 1: 10,325,294 S383P probably damaging Het
Dnah7a A T 1: 53,501,589 I2542N probably benign Het
Eif5b G A 1: 38,051,276 V1179I probably benign Het
Erbin T C 13: 103,920,294 probably null Het
Fastkd5 A T 2: 130,615,250 D473E possibly damaging Het
Fchsd1 T C 18: 37,964,342 E372G probably damaging Het
Fgl1 T C 8: 41,200,609 probably null Het
Fzd8 T G 18: 9,213,797 V293G probably damaging Het
Gm4787 T A 12: 81,378,151 H411L probably benign Het
Gm49380 G T 9: 44,111,972 D326E probably benign Het
Hcrtr1 G A 4: 130,135,290 R240C probably damaging Het
Hdac5 A T 11: 102,197,355 Y948N probably damaging Het
Hepacam A G 9: 37,383,871 S301G probably benign Het
Htra4 A T 8: 25,030,558 D362E possibly damaging Het
Ighv1-9 G A 12: 114,583,741 P60L probably damaging Het
Kcnq3 A G 15: 65,995,541 I751T probably damaging Het
Magi3 T C 3: 104,034,086 Y851C probably damaging Het
Mefv A G 16: 3,713,635 S470P probably benign Het
Mfsd2a C T 4: 122,949,298 V397I probably benign Het
Mroh1 C A 15: 76,433,873 H867N probably benign Het
Mthfd1l C T 10: 4,007,745 R261* probably null Het
Myo3a A G 2: 22,407,346 I725M probably damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nek11 G T 9: 105,392,957 P22Q probably damaging Het
Olfr1179 T C 2: 88,402,113 T274A possibly damaging Het
Olfr1497 A T 19: 13,795,239 V124E possibly damaging Het
Olfr178 T C 16: 58,889,585 T212A probably benign Het
Peg10 C G 6: 4,756,113 Q230E unknown Het
Pipox T C 11: 77,883,909 D116G probably benign Het
Pkd1l2 C T 8: 117,047,497 R993H probably benign Het
Pkdrej A C 15: 85,818,410 N1108K probably damaging Het
Polr2a C T 11: 69,746,376 R291Q probably benign Het
Pomt1 T A 2: 32,244,297 Y277N probably damaging Het
Rasal2 A G 1: 157,299,235 S78P probably damaging Het
Rgl1 A T 1: 152,557,501 L171Q probably damaging Het
Sfta2 A G 17: 35,601,774 E14G unknown Het
Sh3rf3 T A 10: 59,049,355 S353R possibly damaging Het
Slc37a1 A T 17: 31,322,259 I242F probably damaging Het
Srfbp1 T A 18: 52,488,690 D274E probably damaging Het
Syne2 T A 12: 75,912,353 S685R possibly damaging Het
Tenm4 A C 7: 96,895,176 D2170A probably damaging Het
Tnr A G 1: 159,863,695 T472A probably damaging Het
Tspan9 T C 6: 127,965,278 H203R probably damaging Het
Ttn T C 2: 76,771,651 T18556A possibly damaging Het
Usp31 G T 7: 121,649,026 R1065S possibly damaging Het
Vmn2r103 A T 17: 19,811,796 T611S probably damaging Het
Wdfy4 A G 14: 33,142,360 V552A Het
Zap70 G T 1: 36,771,181 R124L possibly damaging Het
Zfand6 A T 7: 84,632,749 S91T possibly damaging Het
Other mutations in Usp25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Usp25 APN 16 77062405 missense probably damaging 1.00
IGL01359:Usp25 APN 16 77059253 missense probably damaging 1.00
IGL01380:Usp25 APN 16 77093678 missense probably benign 0.06
IGL01614:Usp25 APN 16 77077117 missense probably damaging 1.00
IGL02065:Usp25 APN 16 77083782 missense probably benign 0.06
IGL02271:Usp25 APN 16 77115447 missense probably damaging 1.00
IGL03184:Usp25 APN 16 77081653 missense probably damaging 1.00
IGL03046:Usp25 UTSW 16 77074866 missense probably damaging 1.00
R0433:Usp25 UTSW 16 77109217 missense probably benign 0.02
R0741:Usp25 UTSW 16 77071708 missense possibly damaging 0.80
R0944:Usp25 UTSW 16 77081447 splice site probably benign
R1324:Usp25 UTSW 16 77080387 missense probably damaging 0.98
R1341:Usp25 UTSW 16 77115443 missense probably benign
R1373:Usp25 UTSW 16 77062385 splice site probably benign
R1641:Usp25 UTSW 16 77071671 missense possibly damaging 0.89
R1777:Usp25 UTSW 16 77081554 missense probably damaging 1.00
R1813:Usp25 UTSW 16 77114950 missense probably benign 0.00
R1960:Usp25 UTSW 16 77076371 missense probably damaging 1.00
R2256:Usp25 UTSW 16 77113794 missense probably benign
R2271:Usp25 UTSW 16 77076429 missense probably damaging 0.97
R4404:Usp25 UTSW 16 77115453 missense probably damaging 1.00
R4408:Usp25 UTSW 16 77115453 missense probably damaging 1.00
R4502:Usp25 UTSW 16 77115396 missense probably damaging 1.00
R4604:Usp25 UTSW 16 77115415 missense probably damaging 1.00
R4612:Usp25 UTSW 16 77033945 missense possibly damaging 0.92
R4744:Usp25 UTSW 16 77114989 missense probably damaging 1.00
R4867:Usp25 UTSW 16 77050467 missense probably damaging 1.00
R4932:Usp25 UTSW 16 77033982 critical splice donor site probably null
R5087:Usp25 UTSW 16 77077119 missense probably benign 0.00
R5165:Usp25 UTSW 16 77076405 missense possibly damaging 0.85
R5184:Usp25 UTSW 16 77109227 missense probably benign 0.00
R5307:Usp25 UTSW 16 77093706 missense probably benign
R5331:Usp25 UTSW 16 77050558 missense probably damaging 1.00
R5355:Usp25 UTSW 16 77050454 missense probably damaging 1.00
R5479:Usp25 UTSW 16 77107913 missense possibly damaging 0.51
R5619:Usp25 UTSW 16 77033945 missense probably benign 0.22
R5646:Usp25 UTSW 16 77050472 missense probably benign 0.34
R5946:Usp25 UTSW 16 77115054 nonsense probably null
R6013:Usp25 UTSW 16 77077021 missense probably benign 0.00
R6418:Usp25 UTSW 16 77062442 missense probably damaging 1.00
R6653:Usp25 UTSW 16 77059288 missense probably benign 0.29
R6709:Usp25 UTSW 16 77083932 missense probably benign
R6987:Usp25 UTSW 16 77077180 missense probably damaging 1.00
R7418:Usp25 UTSW 16 77113842 nonsense probably null
R7500:Usp25 UTSW 16 77077201 missense probably damaging 1.00
R7886:Usp25 UTSW 16 77113771 missense probably damaging 0.99
R7961:Usp25 UTSW 16 77059262 missense probably damaging 1.00
R8005:Usp25 UTSW 16 77077068 missense probably benign
R8046:Usp25 UTSW 16 77109175 missense probably damaging 1.00
R8069:Usp25 UTSW 16 77069055 missense possibly damaging 0.58
R8167:Usp25 UTSW 16 77107931 missense probably damaging 1.00
R8437:Usp25 UTSW 16 77033912 missense probably damaging 1.00
R8704:Usp25 UTSW 16 77059290 missense probably benign 0.00
R8903:Usp25 UTSW 16 77081533 missense probably damaging 1.00
R9123:Usp25 UTSW 16 77115081 critical splice donor site probably null
R9276:Usp25 UTSW 16 77113833 missense probably benign 0.09
R9286:Usp25 UTSW 16 77107976 missense probably damaging 1.00
R9368:Usp25 UTSW 16 77107955 missense probably damaging 1.00
X0065:Usp25 UTSW 16 77081556 missense probably damaging 1.00
Z1176:Usp25 UTSW 16 77071791 missense probably damaging 0.98
Z1176:Usp25 UTSW 16 77071792 missense possibly damaging 0.93
Z1176:Usp25 UTSW 16 77081521 missense probably damaging 1.00
Z1176:Usp25 UTSW 16 77083913 missense probably benign
Z1176:Usp25 UTSW 16 77113830 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTAGGAAAGTTTTACTCACCC -3'
(R):5'- TTCCCAGCTATGTGATCAGAACC -3'

Sequencing Primer
(F):5'- CATTATTCTCTGGAGCACCATCACTG -3'
(R):5'- CAGAACCTTATACTTGCATTAGGCC -3'
Posted On 2020-06-30