Mutagenetix > Incidental Mutation

Incidental Mutation 'R8140:Usp25'

632502

Institutional Source

Beutler Lab

Gene Symbol

Usp25

Ensembl Gene

ENSMUSG00000022867

Gene Name

ubiquitin specific peptidase 25

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8140 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77013706-77116780 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 77071681 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 323 (Y323*)

Ref Sequence

ENSEMBL: ENSMUSP00000023580 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023580]

AlphaFold

P57080

PDB Structure

Solution Structure of RSGI RUH-013, a UBA domain in Mouse cDNA [SOLUTION NMR]

Predicted Effect

probably null
Transcript: ENSMUST00000023580
AA Change: Y323*

SMART Domains

Protein: ENSMUSP00000023580
Gene: ENSMUSG00000022867
AA Change: Y323*

Domain	Start	End	E-Value	Type
PDB:1VDL\|A	1	67	2e-35	PDB
Blast:UBA	17	56	9e-16	BLAST
UIM	97	116	5.27e-3	SMART
Pfam:UIM	124	140	6.7e-3	PFAM
Pfam:UCH	168	655	9.3e-55	PFAM
Pfam:UCH_1	169	632	3.1e-14	PFAM
coiled coil region	685	714	N/A	INTRINSIC

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 93.9%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin (MIM 191339) is a highly conserved 76-amino acid protein involved in regulation of intracellular protein breakdown, cell cycle regulation, and stress response. Ubiquitin is released from degraded proteins by disassembly of the polyubiquitin chains, which is mediated by ubiquitin-specific proteases (USPs), such as USP25 (Valero et al., 1999 [PubMed 10644437]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased severity of IL17-induced pulmonary inflammation and MOG-induced experimental autoimmune encephalomyelitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	A	5: 63,898,611	V230E	possibly damaging	Het
Amotl1	G	A	9: 14,572,715		probably null	Het
Atp7b	C	A	8: 22,028,560	E87D	probably damaging	Het
Bcat2	C	T	7: 45,588,351	P347L	probably damaging	Het
Brox	A	T	1: 183,293,873		probably null	Het
Cd37	A	G	7: 45,238,535	I58T	probably damaging	Het
Cep295	A	T	9: 15,341,533	M333K	probably benign	Het
Chtop	A	G	3: 90,505,393		probably null	Het
Cpa2	A	T	6: 30,544,905	K54N	probably benign	Het
Cpa6	A	G	1: 10,325,294	S383P	probably damaging	Het
Dnah7a	A	T	1: 53,501,589	I2542N	probably benign	Het
Eif5b	G	A	1: 38,051,276	V1179I	probably benign	Het
Erbin	T	C	13: 103,920,294		probably null	Het
Fastkd5	A	T	2: 130,615,250	D473E	possibly damaging	Het
Fchsd1	T	C	18: 37,964,342	E372G	probably damaging	Het
Fgl1	T	C	8: 41,200,609		probably null	Het
Fzd8	T	G	18: 9,213,797	V293G	probably damaging	Het
Gm4787	T	A	12: 81,378,151	H411L	probably benign	Het
Gm49380	G	T	9: 44,111,972	D326E	probably benign	Het
Hcrtr1	G	A	4: 130,135,290	R240C	probably damaging	Het
Hdac5	A	T	11: 102,197,355	Y948N	probably damaging	Het
Hepacam	A	G	9: 37,383,871	S301G	probably benign	Het
Htra4	A	T	8: 25,030,558	D362E	possibly damaging	Het
Ighv1-9	G	A	12: 114,583,741	P60L	probably damaging	Het
Kcnq3	A	G	15: 65,995,541	I751T	probably damaging	Het
Magi3	T	C	3: 104,034,086	Y851C	probably damaging	Het
Mefv	A	G	16: 3,713,635	S470P	probably benign	Het
Mfsd2a	C	T	4: 122,949,298	V397I	probably benign	Het
Mroh1	C	A	15: 76,433,873	H867N	probably benign	Het
Mthfd1l	C	T	10: 4,007,745	R261*	probably null	Het
Myo3a	A	G	2: 22,407,346	I725M	probably damaging	Het
Neb	T	C	2: 52,209,540	D4766G	possibly damaging	Het
Nek11	G	T	9: 105,392,957	P22Q	probably damaging	Het
Olfr1179	T	C	2: 88,402,113	T274A	possibly damaging	Het
Olfr1497	A	T	19: 13,795,239	V124E	possibly damaging	Het
Olfr178	T	C	16: 58,889,585	T212A	probably benign	Het
Peg10	C	G	6: 4,756,113	Q230E	unknown	Het
Pipox	T	C	11: 77,883,909	D116G	probably benign	Het
Pkd1l2	C	T	8: 117,047,497	R993H	probably benign	Het
Pkdrej	A	C	15: 85,818,410	N1108K	probably damaging	Het
Polr2a	C	T	11: 69,746,376	R291Q	probably benign	Het
Pomt1	T	A	2: 32,244,297	Y277N	probably damaging	Het
Rasal2	A	G	1: 157,299,235	S78P	probably damaging	Het
Rgl1	A	T	1: 152,557,501	L171Q	probably damaging	Het
Sfta2	A	G	17: 35,601,774	E14G	unknown	Het
Sh3rf3	T	A	10: 59,049,355	S353R	possibly damaging	Het
Slc37a1	A	T	17: 31,322,259	I242F	probably damaging	Het
Srfbp1	T	A	18: 52,488,690	D274E	probably damaging	Het
Syne2	T	A	12: 75,912,353	S685R	possibly damaging	Het
Tenm4	A	C	7: 96,895,176	D2170A	probably damaging	Het
Tnr	A	G	1: 159,863,695	T472A	probably damaging	Het
Tspan9	T	C	6: 127,965,278	H203R	probably damaging	Het
Ttn	T	C	2: 76,771,651	T18556A	possibly damaging	Het
Usp31	G	T	7: 121,649,026	R1065S	possibly damaging	Het
Vmn2r103	A	T	17: 19,811,796	T611S	probably damaging	Het
Wdfy4	A	G	14: 33,142,360	V552A		Het
Zap70	G	T	1: 36,771,181	R124L	possibly damaging	Het
Zfand6	A	T	7: 84,632,749	S91T	possibly damaging	Het

Other mutations in Usp25

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00846:Usp25	APN	16	77062405	missense	probably damaging	1.00
IGL01359:Usp25	APN	16	77059253	missense	probably damaging	1.00
IGL01380:Usp25	APN	16	77093678	missense	probably benign	0.06
IGL01614:Usp25	APN	16	77077117	missense	probably damaging	1.00
IGL02065:Usp25	APN	16	77083782	missense	probably benign	0.06
IGL02271:Usp25	APN	16	77115447	missense	probably damaging	1.00
IGL03184:Usp25	APN	16	77081653	missense	probably damaging	1.00
IGL03046:Usp25	UTSW	16	77074866	missense	probably damaging	1.00
R0433:Usp25	UTSW	16	77109217	missense	probably benign	0.02
R0741:Usp25	UTSW	16	77071708	missense	possibly damaging	0.80
R0944:Usp25	UTSW	16	77081447	splice site	probably benign
R1324:Usp25	UTSW	16	77080387	missense	probably damaging	0.98
R1341:Usp25	UTSW	16	77115443	missense	probably benign
R1373:Usp25	UTSW	16	77062385	splice site	probably benign
R1641:Usp25	UTSW	16	77071671	missense	possibly damaging	0.89
R1777:Usp25	UTSW	16	77081554	missense	probably damaging	1.00
R1813:Usp25	UTSW	16	77114950	missense	probably benign	0.00
R1960:Usp25	UTSW	16	77076371	missense	probably damaging	1.00
R2256:Usp25	UTSW	16	77113794	missense	probably benign
R2271:Usp25	UTSW	16	77076429	missense	probably damaging	0.97
R4404:Usp25	UTSW	16	77115453	missense	probably damaging	1.00
R4408:Usp25	UTSW	16	77115453	missense	probably damaging	1.00
R4502:Usp25	UTSW	16	77115396	missense	probably damaging	1.00
R4604:Usp25	UTSW	16	77115415	missense	probably damaging	1.00
R4612:Usp25	UTSW	16	77033945	missense	possibly damaging	0.92
R4744:Usp25	UTSW	16	77114989	missense	probably damaging	1.00
R4867:Usp25	UTSW	16	77050467	missense	probably damaging	1.00
R4932:Usp25	UTSW	16	77033982	critical splice donor site	probably null
R5087:Usp25	UTSW	16	77077119	missense	probably benign	0.00
R5165:Usp25	UTSW	16	77076405	missense	possibly damaging	0.85
R5184:Usp25	UTSW	16	77109227	missense	probably benign	0.00
R5307:Usp25	UTSW	16	77093706	missense	probably benign
R5331:Usp25	UTSW	16	77050558	missense	probably damaging	1.00
R5355:Usp25	UTSW	16	77050454	missense	probably damaging	1.00
R5479:Usp25	UTSW	16	77107913	missense	possibly damaging	0.51
R5619:Usp25	UTSW	16	77033945	missense	probably benign	0.22
R5646:Usp25	UTSW	16	77050472	missense	probably benign	0.34
R5946:Usp25	UTSW	16	77115054	nonsense	probably null
R6013:Usp25	UTSW	16	77077021	missense	probably benign	0.00
R6418:Usp25	UTSW	16	77062442	missense	probably damaging	1.00
R6653:Usp25	UTSW	16	77059288	missense	probably benign	0.29
R6709:Usp25	UTSW	16	77083932	missense	probably benign
R6987:Usp25	UTSW	16	77077180	missense	probably damaging	1.00
R7418:Usp25	UTSW	16	77113842	nonsense	probably null
R7500:Usp25	UTSW	16	77077201	missense	probably damaging	1.00
R7886:Usp25	UTSW	16	77113771	missense	probably damaging	0.99
R7961:Usp25	UTSW	16	77059262	missense	probably damaging	1.00
R8005:Usp25	UTSW	16	77077068	missense	probably benign
R8046:Usp25	UTSW	16	77109175	missense	probably damaging	1.00
R8069:Usp25	UTSW	16	77069055	missense	possibly damaging	0.58
R8167:Usp25	UTSW	16	77107931	missense	probably damaging	1.00
R8437:Usp25	UTSW	16	77033912	missense	probably damaging	1.00
R8704:Usp25	UTSW	16	77059290	missense	probably benign	0.00
R8903:Usp25	UTSW	16	77081533	missense	probably damaging	1.00
R9123:Usp25	UTSW	16	77115081	critical splice donor site	probably null
R9276:Usp25	UTSW	16	77113833	missense	probably benign	0.09
R9286:Usp25	UTSW	16	77107976	missense	probably damaging	1.00
R9368:Usp25	UTSW	16	77107955	missense	probably damaging	1.00
R9489:Usp25	UTSW	16	77077158	missense	probably damaging	1.00
R9515:Usp25	UTSW	16	77055188	missense	probably damaging	1.00
R9516:Usp25	UTSW	16	77055188	missense	probably damaging	1.00
R9580:Usp25	UTSW	16	77083794	missense	probably benign	0.00
R9605:Usp25	UTSW	16	77077158	missense	probably damaging	1.00
R9667:Usp25	UTSW	16	77077235	critical splice donor site	probably null
X0065:Usp25	UTSW	16	77081556	missense	probably damaging	1.00
Z1176:Usp25	UTSW	16	77071791	missense	probably damaging	0.98
Z1176:Usp25	UTSW	16	77071792	missense	possibly damaging	0.93
Z1176:Usp25	UTSW	16	77081521	missense	probably damaging	1.00
Z1176:Usp25	UTSW	16	77083913	missense	probably benign
Z1176:Usp25	UTSW	16	77113830	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGTAGGAAAGTTTTACTCACCC -3'
(R):5'- TTCCCAGCTATGTGATCAGAACC -3'

Sequencing Primer
(F):5'- CATTATTCTCTGGAGCACCATCACTG -3'
(R):5'- CAGAACCTTATACTTGCATTAGGCC -3'

Posted On

2020-06-30