Incidental Mutation 'R8140:Fzd8'
ID 632506
Institutional Source Beutler Lab
Gene Symbol Fzd8
Ensembl Gene ENSMUSG00000036904
Gene Name frizzled class receptor 8
Synonyms mFZ8, Fz8
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8140 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 9212856-9216201 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 9213797 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 293 (V293G)
Ref Sequence ENSEMBL: ENSMUSP00000039660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041080]
AlphaFold Q61091
PDB Structure CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MOUSE FRIZZLED 8 (MFZ8) [X-RAY DIFFRACTION]
Crystal structure of XWnt8 in complex with the cysteine-rich domain of Frizzled 8 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000041080
AA Change: V293G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039660
Gene: ENSMUSG00000036904
AA Change: V293G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FRI 34 153 9.06e-73 SMART
low complexity region 161 228 N/A INTRINSIC
Frizzled 264 621 1.47e-219 SMART
low complexity region 624 655 N/A INTRINSIC
Meta Mutation Damage Score 0.7383 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 93.9%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. This gene is highly expressed in two human cancer cell lines, indicating that it may play a role in several types of cancer. The crystal structure of the extracellular cysteine-rich domain of a similar mouse protein has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T A 5: 63,898,611 V230E possibly damaging Het
Amotl1 G A 9: 14,572,715 probably null Het
Atp7b C A 8: 22,028,560 E87D probably damaging Het
Bcat2 C T 7: 45,588,351 P347L probably damaging Het
Brox A T 1: 183,293,873 probably null Het
Cd37 A G 7: 45,238,535 I58T probably damaging Het
Cep295 A T 9: 15,341,533 M333K probably benign Het
Chtop A G 3: 90,505,393 probably null Het
Cpa2 A T 6: 30,544,905 K54N probably benign Het
Cpa6 A G 1: 10,325,294 S383P probably damaging Het
Dnah7a A T 1: 53,501,589 I2542N probably benign Het
Eif5b G A 1: 38,051,276 V1179I probably benign Het
Erbin T C 13: 103,920,294 probably null Het
Fastkd5 A T 2: 130,615,250 D473E possibly damaging Het
Fchsd1 T C 18: 37,964,342 E372G probably damaging Het
Fgl1 T C 8: 41,200,609 probably null Het
Gm4787 T A 12: 81,378,151 H411L probably benign Het
Gm49380 G T 9: 44,111,972 D326E probably benign Het
Hcrtr1 G A 4: 130,135,290 R240C probably damaging Het
Hdac5 A T 11: 102,197,355 Y948N probably damaging Het
Hepacam A G 9: 37,383,871 S301G probably benign Het
Htra4 A T 8: 25,030,558 D362E possibly damaging Het
Ighv1-9 G A 12: 114,583,741 P60L probably damaging Het
Kcnq3 A G 15: 65,995,541 I751T probably damaging Het
Magi3 T C 3: 104,034,086 Y851C probably damaging Het
Mefv A G 16: 3,713,635 S470P probably benign Het
Mfsd2a C T 4: 122,949,298 V397I probably benign Het
Mroh1 C A 15: 76,433,873 H867N probably benign Het
Mthfd1l C T 10: 4,007,745 R261* probably null Het
Myo3a A G 2: 22,407,346 I725M probably damaging Het
Neb T C 2: 52,209,540 D4766G possibly damaging Het
Nek11 G T 9: 105,392,957 P22Q probably damaging Het
Olfr1179 T C 2: 88,402,113 T274A possibly damaging Het
Olfr1497 A T 19: 13,795,239 V124E possibly damaging Het
Olfr178 T C 16: 58,889,585 T212A probably benign Het
Peg10 C G 6: 4,756,113 Q230E unknown Het
Pipox T C 11: 77,883,909 D116G probably benign Het
Pkd1l2 C T 8: 117,047,497 R993H probably benign Het
Pkdrej A C 15: 85,818,410 N1108K probably damaging Het
Polr2a C T 11: 69,746,376 R291Q probably benign Het
Pomt1 T A 2: 32,244,297 Y277N probably damaging Het
Rasal2 A G 1: 157,299,235 S78P probably damaging Het
Rgl1 A T 1: 152,557,501 L171Q probably damaging Het
Sfta2 A G 17: 35,601,774 E14G unknown Het
Sh3rf3 T A 10: 59,049,355 S353R possibly damaging Het
Slc37a1 A T 17: 31,322,259 I242F probably damaging Het
Srfbp1 T A 18: 52,488,690 D274E probably damaging Het
Syne2 T A 12: 75,912,353 S685R possibly damaging Het
Tenm4 A C 7: 96,895,176 D2170A probably damaging Het
Tnr A G 1: 159,863,695 T472A probably damaging Het
Tspan9 T C 6: 127,965,278 H203R probably damaging Het
Ttn T C 2: 76,771,651 T18556A possibly damaging Het
Usp25 T A 16: 77,071,681 Y323* probably null Het
Usp31 G T 7: 121,649,026 R1065S possibly damaging Het
Vmn2r103 A T 17: 19,811,796 T611S probably damaging Het
Wdfy4 A G 14: 33,142,360 V552A Het
Zap70 G T 1: 36,771,181 R124L possibly damaging Het
Zfand6 A T 7: 84,632,749 S91T possibly damaging Het
Other mutations in Fzd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Fzd8 APN 18 9213068 missense unknown
IGL01511:Fzd8 APN 18 9213293 missense unknown
IGL03129:Fzd8 APN 18 9214270 missense probably damaging 1.00
Stilt UTSW 18 9213880 missense probably damaging 1.00
R0058:Fzd8 UTSW 18 9213985 missense possibly damaging 0.92
R0715:Fzd8 UTSW 18 9212947 missense unknown
R0966:Fzd8 UTSW 18 9214745 missense probably damaging 0.99
R1717:Fzd8 UTSW 18 9214364 missense probably damaging 1.00
R1751:Fzd8 UTSW 18 9213643 missense probably damaging 0.98
R1761:Fzd8 UTSW 18 9213643 missense probably damaging 0.98
R1905:Fzd8 UTSW 18 9213803 missense probably damaging 1.00
R1956:Fzd8 UTSW 18 9214502 missense probably damaging 1.00
R2892:Fzd8 UTSW 18 9214514 missense probably damaging 1.00
R3897:Fzd8 UTSW 18 9214939 missense possibly damaging 0.89
R3968:Fzd8 UTSW 18 9214070 missense probably damaging 0.98
R4934:Fzd8 UTSW 18 9214492 frame shift probably null
R5366:Fzd8 UTSW 18 9213880 missense probably damaging 1.00
R5624:Fzd8 UTSW 18 9213268 missense unknown
R6261:Fzd8 UTSW 18 9214598 missense possibly damaging 0.61
R6757:Fzd8 UTSW 18 9213238 missense possibly damaging 0.78
R6758:Fzd8 UTSW 18 9213238 missense possibly damaging 0.78
R6899:Fzd8 UTSW 18 9214729 missense probably damaging 0.98
R7242:Fzd8 UTSW 18 9214171 missense probably damaging 1.00
R8324:Fzd8 UTSW 18 9214688 missense probably damaging 1.00
R8722:Fzd8 UTSW 18 9213686 missense possibly damaging 0.67
R8818:Fzd8 UTSW 18 9214474 missense probably benign 0.26
R8820:Fzd8 UTSW 18 9213247 missense unknown
R8913:Fzd8 UTSW 18 9213869 missense probably damaging 1.00
R9036:Fzd8 UTSW 18 9214661 missense probably damaging 1.00
R9401:Fzd8 UTSW 18 9213205 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TGTGCATGGACTACAACCGC -3'
(R):5'- TCATAGCGAACATGCTGCTCG -3'

Sequencing Primer
(F):5'- TGGACTACAACCGCACCGAC -3'
(R):5'- AACATGCTGCTCGACTGC -3'
Posted On 2020-06-30