Incidental Mutation 'R0042:Taar6'
ID 63251
Institutional Source Beutler Lab
Gene Symbol Taar6
Ensembl Gene ENSMUSG00000045111
Gene Name trace amine-associated receptor 6
Synonyms LOC215855
MMRRC Submission 038336-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.179) question?
Stock # R0042 (G1)
Quality Score 122
Status Validated
Chromosome 10
Chromosomal Location 23860507-23861544 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23861021 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 175 (D175G)
Ref Sequence ENSEMBL: ENSMUSP00000097603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057080]
AlphaFold Q5QD13
Predicted Effect probably benign
Transcript: ENSMUST00000057080
AA Change: D175G

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097603
Gene: ENSMUSG00000045111
AA Change: D175G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 326 5.5e-13 PFAM
Pfam:7tm_1 49 311 5.9e-58 PFAM
Meta Mutation Damage Score 0.1824 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-transmembrane G-protein-coupled receptor that likely functions as a receptor for endogenous trace amines. Mutations in this gene may be associated with schizophrenia.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 C T 4: 53,059,245 (GRCm39) probably benign Het
Acr T A 15: 89,458,535 (GRCm39) H405Q probably benign Het
Adad1 T C 3: 37,137,322 (GRCm39) probably benign Het
Alox5ap T C 5: 149,216,069 (GRCm39) probably benign Het
Ank2 T C 3: 126,730,280 (GRCm39) D3568G probably damaging Het
Atl3 T G 19: 7,506,388 (GRCm39) I306S probably damaging Het
Atr T A 9: 95,809,409 (GRCm39) probably benign Het
Ccnb2 A G 9: 70,326,335 (GRCm39) V34A probably benign Het
Cdh12 A C 15: 21,537,763 (GRCm39) probably benign Het
Cib1 C T 7: 79,880,126 (GRCm39) V45M probably benign Het
Col6a6 T C 9: 105,657,896 (GRCm39) E772G possibly damaging Het
Dmxl1 C A 18: 49,997,102 (GRCm39) T466K probably benign Het
Dym T C 18: 75,258,610 (GRCm39) probably null Het
Enpp3 A C 10: 24,650,722 (GRCm39) F805V probably damaging Het
Eya1 T C 1: 14,254,713 (GRCm39) D373G probably damaging Het
Gpr179 C T 11: 97,225,757 (GRCm39) V2133I probably benign Het
Grb10 G T 11: 11,886,798 (GRCm39) H435Q probably damaging Het
Gzmm T C 10: 79,530,399 (GRCm39) I190T probably benign Het
Helt T C 8: 46,745,433 (GRCm39) Y150C probably damaging Het
Hrg A T 16: 22,779,886 (GRCm39) probably benign Het
Il17ra T C 6: 120,449,086 (GRCm39) probably benign Het
Inhbc A G 10: 127,193,302 (GRCm39) I238T probably benign Het
Itgb3 A G 11: 104,557,966 (GRCm39) T787A possibly damaging Het
Jakmip2 T G 18: 43,685,210 (GRCm39) probably benign Het
Krt4 T G 15: 101,831,187 (GRCm39) probably benign Het
Lgsn C T 1: 31,229,534 (GRCm39) T85I probably benign Het
Metap1 C T 3: 138,177,918 (GRCm39) V217I probably benign Het
Mib2 A T 4: 155,743,897 (GRCm39) C48* probably null Het
Mroh4 T A 15: 74,482,154 (GRCm39) I768F probably damaging Het
Npas3 T A 12: 54,095,624 (GRCm39) D361E probably damaging Het
Obscn A G 11: 58,943,411 (GRCm39) L4246P probably damaging Het
Or4a78 A C 2: 89,497,798 (GRCm39) V144G probably benign Het
Or7e169 A G 9: 19,757,075 (GRCm39) M280T probably benign Het
Or8h7 A G 2: 86,720,835 (GRCm39) I228T probably damaging Het
P4hb G A 11: 120,459,092 (GRCm39) R134C probably damaging Het
Plcb3 T C 19: 6,943,788 (GRCm39) D71G probably damaging Het
Prex2 T A 1: 11,150,305 (GRCm39) V159E probably damaging Het
Prpsap1 T A 11: 116,370,482 (GRCm39) K158N probably benign Het
Prr35 C A 17: 26,166,956 (GRCm39) E194* probably null Het
Ptger1 G T 8: 84,394,795 (GRCm39) V91L probably benign Het
Rdh10 T C 1: 16,178,260 (GRCm39) probably benign Het
Rgs9bp C A 7: 35,284,458 (GRCm39) R63L probably damaging Het
Slc13a5 A T 11: 72,149,940 (GRCm39) V173E probably benign Het
Spata31 A T 13: 65,070,377 (GRCm39) I842L probably benign Het
Stk32b A C 5: 37,874,092 (GRCm39) D13E probably benign Het
Svep1 T C 4: 58,123,192 (GRCm39) D708G possibly damaging Het
Thbs1 A C 2: 117,953,358 (GRCm39) D925A probably damaging Het
Tnr A T 1: 159,714,595 (GRCm39) T825S probably benign Het
Ttc23l A C 15: 10,551,627 (GRCm39) L33W probably damaging Het
Ttc39d T C 17: 80,523,379 (GRCm39) Y13H probably benign Het
Vmn2r102 C A 17: 19,880,851 (GRCm39) P64Q probably damaging Het
Vps11 G T 9: 44,267,588 (GRCm39) Y341* probably null Het
Vsig8 T C 1: 172,387,925 (GRCm39) V5A possibly damaging Het
Vwce C T 19: 10,624,177 (GRCm39) A356V probably benign Het
Other mutations in Taar6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Taar6 APN 10 23,861,406 (GRCm39) missense probably benign 0.15
IGL00918:Taar6 APN 10 23,861,480 (GRCm39) missense probably damaging 1.00
IGL01060:Taar6 APN 10 23,860,970 (GRCm39) missense probably benign
IGL02608:Taar6 APN 10 23,861,081 (GRCm39) missense probably benign 0.01
R0042:Taar6 UTSW 10 23,861,021 (GRCm39) missense probably benign 0.36
R0360:Taar6 UTSW 10 23,861,046 (GRCm39) missense probably benign 0.01
R0364:Taar6 UTSW 10 23,861,046 (GRCm39) missense probably benign 0.01
R0746:Taar6 UTSW 10 23,861,258 (GRCm39) missense probably benign 0.43
R1637:Taar6 UTSW 10 23,861,079 (GRCm39) missense probably benign 0.12
R4893:Taar6 UTSW 10 23,861,298 (GRCm39) missense probably benign
R4944:Taar6 UTSW 10 23,860,613 (GRCm39) missense probably damaging 1.00
R4951:Taar6 UTSW 10 23,861,106 (GRCm39) missense probably benign 0.09
R5173:Taar6 UTSW 10 23,861,250 (GRCm39) missense probably damaging 1.00
R5181:Taar6 UTSW 10 23,860,683 (GRCm39) missense possibly damaging 0.76
R5919:Taar6 UTSW 10 23,861,168 (GRCm39) missense probably damaging 1.00
R5988:Taar6 UTSW 10 23,861,154 (GRCm39) missense probably damaging 0.98
R6327:Taar6 UTSW 10 23,861,177 (GRCm39) missense probably damaging 1.00
R6493:Taar6 UTSW 10 23,861,021 (GRCm39) missense probably benign 0.36
R7595:Taar6 UTSW 10 23,860,968 (GRCm39) missense probably benign
R7802:Taar6 UTSW 10 23,861,151 (GRCm39) missense probably benign 0.02
R8053:Taar6 UTSW 10 23,861,144 (GRCm39) missense possibly damaging 0.59
R8506:Taar6 UTSW 10 23,861,529 (GRCm39) missense probably benign 0.01
R9169:Taar6 UTSW 10 23,861,273 (GRCm39) missense probably damaging 0.99
R9272:Taar6 UTSW 10 23,860,903 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAATGCTACCACGGTAATCCCCAG -3'
(R):5'- CATCTCCATCGACAGGTACATCGC -3'

Sequencing Primer
(F):5'- CTTTGTAGCTCTCAGAGGATGATTC -3'
(R):5'- ACAGGTACATCGCTGTCACG -3'
Posted On 2013-07-30